Incidental Mutation 'R7610:Acta2'
ID588572
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Nameactin, alpha 2, smooth muscle, aorta
SynonymsalphaSMA, SMalphaA, 0610041G09Rik, Actvs, a-SMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R7610 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34241090-34255336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34252531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: T8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: T8I

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,111,187 N338K probably damaging Het
Adtrp A G 13: 41,816,194 F110L probably benign Het
Akap9 T G 5: 3,957,677 D230E possibly damaging Het
Alg11 G A 8: 22,065,131 R136H probably damaging Het
Ank3 A T 10: 69,986,422 N307I Het
Ankrd17 A G 5: 90,232,363 S2489P possibly damaging Het
Asf1b T G 8: 83,965,049 I43S probably damaging Het
Cdc37l1 G T 19: 29,007,732 G261W possibly damaging Het
Cpped1 C A 16: 11,894,878 probably null Het
Ctsk T C 3: 95,500,844 F4L probably benign Het
D130043K22Rik A T 13: 24,876,002 T619S probably benign Het
Ddx25 T A 9: 35,554,597 L109F possibly damaging Het
Dhrs9 C A 2: 69,392,947 A13D unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam228a A G 12: 4,731,423 probably null Het
Fancm T C 12: 65,105,680 V970A probably damaging Het
Fcrls C A 3: 87,252,697 V417F probably damaging Het
Fig4 C A 10: 41,253,713 A504S probably damaging Het
Frmpd1 T C 4: 45,279,098 S608P probably damaging Het
Ggta1 C T 2: 35,414,218 probably null Het
Gm13084 A T 4: 143,812,866 M19K probably damaging Het
Grb10 T C 11: 11,943,955 K377R probably benign Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Klf14 A G 6: 30,958,070 S210P probably damaging Het
Marc2 A G 1: 184,819,286 Y318H probably benign Het
Mcm3ap A G 10: 76,496,720 probably null Het
Mgrn1 T C 16: 4,934,233 *533Q probably null Het
Notch1 A T 2: 26,478,179 H598Q probably benign Het
Ntng1 A G 3: 109,934,825 S211P probably damaging Het
Olfr1104 A G 2: 87,021,797 V249A possibly damaging Het
Olfr532 A T 7: 140,419,553 C73* probably null Het
Pgm5 A C 19: 24,834,756 N137K probably damaging Het
Plcb2 T A 2: 118,719,759 N172I possibly damaging Het
Rab11fip1 G A 8: 27,152,036 H912Y probably benign Het
Rgl1 A G 1: 152,552,620 V251A probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Rhpn1 A G 15: 75,712,396 T446A unknown Het
Rtn3 A G 19: 7,457,929 S233P probably damaging Het
Rwdd1 A C 10: 34,001,138 D203E probably benign Het
Samd9l A G 6: 3,376,754 V169A probably benign Het
Slfn5 T C 11: 82,961,484 L812P probably damaging Het
Smc1b T C 15: 85,070,820 D1077G possibly damaging Het
Snrnp48 A G 13: 38,209,961 R81G probably damaging Het
Syt17 A T 7: 118,434,459 probably null Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttc3 T C 16: 94,427,838 I757T probably benign Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Wdr54 C T 6: 83,152,858 V305M possibly damaging Het
Xirp2 C T 2: 67,525,962 T3689I possibly damaging Het
Zscan18 T C 7: 12,769,310 K774R probably damaging Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34251791 missense probably damaging 0.98
IGL01802:Acta2 APN 19 34243436 missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34251854 missense probably benign 0.03
IGL02136:Acta2 APN 19 34251830 missense probably damaging 1.00
IGL03114:Acta2 APN 19 34244910 critical splice donor site probably null
R0648:Acta2 UTSW 19 34248534 missense probably benign
R1393:Acta2 UTSW 19 34241792 missense probably damaging 1.00
R1597:Acta2 UTSW 19 34252583 splice site probably benign
R2045:Acta2 UTSW 19 34243399 missense probably damaging 1.00
R2338:Acta2 UTSW 19 34248541 splice site probably benign
R3113:Acta2 UTSW 19 34243352 missense probably benign
R3940:Acta2 UTSW 19 34243480 missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34251726 splice site probably benign
R4765:Acta2 UTSW 19 34246152 missense probably damaging 1.00
R4826:Acta2 UTSW 19 34251823 nonsense probably null
R6453:Acta2 UTSW 19 34246657 missense probably damaging 1.00
R6754:Acta2 UTSW 19 34244983 missense probably damaging 1.00
R6941:Acta2 UTSW 19 34252522 missense probably damaging 1.00
R7311:Acta2 UTSW 19 34241786 missense probably damaging 1.00
R7461:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7463:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7464:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7536:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7537:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7605:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7609:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7611:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7613:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7626:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7627:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7803:Acta2 UTSW 19 34243418 missense probably benign
R7872:Acta2 UTSW 19 34243439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACACAGAGGGATCTAGCC -3'
(R):5'- GGATCATCAAAGGCTTTACAGC -3'

Sequencing Primer
(F):5'- AGGGATCTAGCCTAAAGTCTTGTCC -3'
(R):5'- GCTTTACAGCCTAGTGAAAGC -3'
Posted On2019-10-24