Mutagenetix > Incidental Mutation

Incidental Mutation 'R7611:Sulf1'

588573

Institutional Source

Beutler Lab

Gene Symbol

Sulf1

Ensembl Gene

ENSMUSG00000016918

Gene Name

sulfatase 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R7611 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12692277-12861192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12836243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 503 (E503G)

Ref Sequence

ENSEMBL: ENSMUSP00000085949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]

AlphaFold

Q8K007

Predicted Effect

probably benign
Transcript: ENSMUST00000088585
AA Change: E503G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: E503G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177608
AA Change: E503G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: E503G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	534	678	9.7e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180062
AA Change: E503G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: E503G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186051
AA Change: E503G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: E503G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.4e-56	PFAM
Pfam:Phosphodiest	61	323	9.6e-8	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	1.1e-48	PFAM
low complexity region	717	737	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	G	8: 45,970,451	Y75H	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adcy8	C	T	15: 64,921,033	G25S	probably benign	Het
Ahnak2	G	T	12: 112,788,129	D35E		Het
Birc6	T	C	17: 74,662,718	M4261T	probably damaging	Het
Caln1	T	G	5: 130,506,077	F45V	probably damaging	Het
Camta2	A	T	11: 70,681,546	I313N	possibly damaging	Het
Capns1	T	A	7: 30,190,114	E220V	probably damaging	Het
Carmil1	C	A	13: 24,013,332	V1374L	probably benign	Het
Casp2	T	G	6: 42,274,038	L290R	possibly damaging	Het
Cdkn2b	C	A	4: 89,310,743	V19L	probably benign	Het
Ces1c	T	C	8: 93,124,511	N162D	probably benign	Het
Chd9	T	C	8: 91,036,389	S2281P	probably damaging	Het
Chst13	T	C	6: 90,309,017	D321G	probably damaging	Het
Ckap2l	G	T	2: 129,285,680	P193T	possibly damaging	Het
Clca4b	T	A	3: 144,921,996	T405S	probably benign	Het
Cmah	T	C	13: 24,435,647	V265A	probably benign	Het
Cyp3a11	A	T	5: 145,860,381	M396K	probably benign	Het
Ddr2	A	T	1: 169,998,158	M291K	possibly damaging	Het
Ddx43	T	A	9: 78,402,353	I145N	probably benign	Het
Ddx58	T	C	4: 40,225,651	E250G	probably damaging	Het
Ephb2	T	A	4: 136,660,901		probably null	Het
Fgfr1	A	T	8: 25,558,205	K106*	probably null	Het
Gpr6	A	G	10: 41,070,879	F236L	probably benign	Het
Grin2c	A	G	11: 115,252,685	S750P	probably damaging	Het
Hecw2	A	G	1: 53,913,300	S925P	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Hmg20b	T	A	10: 81,349,598		probably benign	Het
Kcnk10	T	A	12: 98,518,640	Y79F	probably damaging	Het
Lrrc30	A	T	17: 67,632,429	F52Y	probably damaging	Het
Lrriq1	T	C	10: 103,200,571	K907R	possibly damaging	Het
Mbd3	T	C	10: 80,395,518	D63G	probably damaging	Het
Mettl21a	C	T	1: 64,615,107	A84T	probably benign	Het
Mmp19	A	G	10: 128,798,988	D491G	probably benign	Het
Mug1	A	T	6: 121,875,428		probably null	Het
Myh1	A	T	11: 67,210,417	H673L	possibly damaging	Het
Nlrc5	T	C	8: 94,512,648		probably null	Het
Nme9	T	A	9: 99,470,790	S264R	probably benign	Het
Nup153	T	C	13: 46,687,322	T937A	probably benign	Het
Obsl1	T	C	1: 75,505,380	E282G	probably damaging	Het
Olfr1030	T	A	2: 85,984,063	C74*	probably null	Het
Olfr1076	T	A	2: 86,509,053	I198K	possibly damaging	Het
Olfr1364	A	G	13: 21,574,318	V46A	probably benign	Het
Olfr1436	T	A	19: 12,298,878	M85L	probably damaging	Het
Olfr1451	T	A	19: 12,999,067	I27N	possibly damaging	Het
Olfr724	C	A	14: 49,960,911	A54S	probably benign	Het
Olfr98	A	G	17: 37,262,854	V270A	probably benign	Het
Pcdhga12	T	C	18: 37,768,425	F770S	possibly damaging	Het
Pfkp	T	A	13: 6,605,083		probably null	Het
Prr29	C	G	11: 106,376,332	H58D	probably damaging	Het
Ptprz1	T	A	6: 23,001,220	M1103K	probably benign	Het
Rsph4a	C	T	10: 33,905,477	P108S	probably benign	Het
Setd1b	A	C	5: 123,152,594	M875L	unknown	Het
Slc15a2	A	G	16: 36,756,311	S485P	probably benign	Het
Smoc1	A	G	12: 81,179,670	D423G	probably damaging	Het
Spast	T	A	17: 74,369,203	V337D	probably damaging	Het
Spesp1	T	C	9: 62,272,705	K307R	possibly damaging	Het
Susd6	T	C	12: 80,874,567	Y313H	probably damaging	Het
Them4	A	T	3: 94,331,558	D224V	possibly damaging	Het
Tpsg1	G	T	17: 25,373,210	G86V	probably damaging	Het
Tspear	A	T	10: 77,881,215	T575S	probably benign	Het
Usp21	A	T	1: 171,285,569	H211Q	probably benign	Het
Vmn1r189	T	C	13: 22,102,152	S172G	probably benign	Het
Vmn2r114	T	C	17: 23,296,970	S516G	probably damaging	Het
Vmn2r28	T	A	7: 5,481,256	R648S	probably benign	Het
Vmn2r6	C	A	3: 64,565,142	V53F	probably damaging	Het
Vmn2r76	A	G	7: 86,230,180	I304T	probably benign	Het
Vmn2r88	A	C	14: 51,413,997	Y256S		Het
Zfhx4	A	T	3: 5,403,771	K3021N	probably damaging	Het
Zfp647	T	C	15: 76,911,788	H224R	probably damaging	Het
Zfp865	A	G	7: 5,031,131	E705G	probably damaging	Het

Other mutations in Sulf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Sulf1	APN	1	12820463	missense	probably damaging	0.99
IGL00788:Sulf1	APN	1	12848449	missense	probably damaging	0.99
IGL00845:Sulf1	APN	1	12796967	missense	probably damaging	1.00
IGL01606:Sulf1	APN	1	12836204	missense	possibly damaging	0.87
IGL01963:Sulf1	APN	1	12818507	missense	probably damaging	1.00
IGL01968:Sulf1	APN	1	12818451	missense	probably damaging	1.00
IGL02072:Sulf1	APN	1	12848208	missense	probably damaging	1.00
IGL02424:Sulf1	APN	1	12796840	missense	probably benign	0.28
IGL02519:Sulf1	APN	1	12838363	nonsense	probably null
IGL02601:Sulf1	APN	1	12786645	missense	probably damaging	1.00
IGL03066:Sulf1	APN	1	12807944	missense	probably damaging	0.99
IGL03200:Sulf1	APN	1	12786617	nonsense	probably null
PIT4480001:Sulf1	UTSW	1	12859413	missense	probably benign	0.01
PIT4519001:Sulf1	UTSW	1	12848171	missense	probably damaging	1.00
R0083:Sulf1	UTSW	1	12817417	missense	probably damaging	0.99
R0467:Sulf1	UTSW	1	12796920	missense	probably damaging	1.00
R0554:Sulf1	UTSW	1	12805194	missense	probably damaging	1.00
R0626:Sulf1	UTSW	1	12817492	splice site	probably null
R1083:Sulf1	UTSW	1	12836164	frame shift	probably null
R1084:Sulf1	UTSW	1	12836164	frame shift	probably null
R1498:Sulf1	UTSW	1	12848350	missense	probably damaging	1.00
R1523:Sulf1	UTSW	1	12817350	nonsense	probably null
R1854:Sulf1	UTSW	1	12838437	missense	probably benign	0.06
R1942:Sulf1	UTSW	1	12848173	missense	probably damaging	1.00
R1946:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R1998:Sulf1	UTSW	1	12858834	nonsense	probably null
R2034:Sulf1	UTSW	1	12820421	missense	probably damaging	1.00
R2068:Sulf1	UTSW	1	12840403	missense	probably damaging	1.00
R2113:Sulf1	UTSW	1	12848174	missense	probably damaging	0.99
R2277:Sulf1	UTSW	1	12796794	missense	probably benign	0.41
R3827:Sulf1	UTSW	1	12817432	missense	probably benign
R3874:Sulf1	UTSW	1	12817412	missense	probably damaging	1.00
R4488:Sulf1	UTSW	1	12786515	start gained	probably benign
R4619:Sulf1	UTSW	1	12786652	missense	probably damaging	1.00
R4743:Sulf1	UTSW	1	12836293	missense	probably benign	0.04
R4836:Sulf1	UTSW	1	12842686	missense	probably benign	0.02
R4918:Sulf1	UTSW	1	12818496	missense	probably damaging	1.00
R4958:Sulf1	UTSW	1	12796910	missense	probably benign	0.08
R5216:Sulf1	UTSW	1	12796874	missense	probably benign	0.28
R5225:Sulf1	UTSW	1	12841478	missense	probably benign
R5427:Sulf1	UTSW	1	12796912	missense	possibly damaging	0.84
R5450:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R5909:Sulf1	UTSW	1	12858815	missense	possibly damaging	0.94
R5912:Sulf1	UTSW	1	12786752	unclassified	probably benign
R5966:Sulf1	UTSW	1	12859412	missense	probably benign	0.06
R6339:Sulf1	UTSW	1	12838440	missense	probably damaging	1.00
R6841:Sulf1	UTSW	1	12838434	missense	probably damaging	1.00
R6880:Sulf1	UTSW	1	12842755	missense	probably damaging	1.00
R7110:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R7255:Sulf1	UTSW	1	12859008	missense	probably benign	0.00
R7275:Sulf1	UTSW	1	12850965	splice site	probably null
R7386:Sulf1	UTSW	1	12838361	missense	probably benign	0.07
R7732:Sulf1	UTSW	1	12842789	missense	probably benign	0.11
R7796:Sulf1	UTSW	1	12858820	missense	probably benign	0.27
R7898:Sulf1	UTSW	1	12805294	missense	probably damaging	1.00
R7984:Sulf1	UTSW	1	12859273	missense	probably benign	0.00
R8003:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R8684:Sulf1	UTSW	1	12796780	missense	probably benign	0.06
R8714:Sulf1	UTSW	1	12807917	missense	probably benign	0.07
R8723:Sulf1	UTSW	1	12786687	missense	probably damaging	1.00
R8988:Sulf1	UTSW	1	12836275	missense	probably benign
R9055:Sulf1	UTSW	1	12807963	missense	probably damaging	1.00
R9100:Sulf1	UTSW	1	12807894	missense	probably damaging	1.00
R9288:Sulf1	UTSW	1	12786603	missense	probably benign	0.09
R9358:Sulf1	UTSW	1	12820505	missense	probably damaging	1.00
R9387:Sulf1	UTSW	1	12838554	missense	probably benign	0.02
R9462:Sulf1	UTSW	1	12859235	missense	probably damaging	1.00
R9524:Sulf1	UTSW	1	12848398	missense	probably damaging	1.00
R9581:Sulf1	UTSW	1	12805254	missense	possibly damaging	0.66
R9664:Sulf1	UTSW	1	12820802	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTAAATAACAACTGGCTCAGCATC -3'
(R):5'- ATCTAGGCACCGAGAACATCTC -3'

Sequencing Primer
(F):5'- GCTCAGCATCGCCAACTG -3'
(R):5'- GGCACCGAGAACATCTCATTTGTG -3'

Posted On

2019-10-24