Incidental Mutation 'R7611:Usp21'
ID588578
Institutional Source Beutler Lab
Gene Symbol Usp21
Ensembl Gene ENSMUSG00000053483
Gene Nameubiquitin specific peptidase 21
SynonymsUsp23, W53272, ESTM28, Usp16
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171281945-171287991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171285569 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 211 (H211Q)
Ref Sequence ENSEMBL: ENSMUSP00000106938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000080001] [ENSMUST00000111302] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000144576] [ENSMUST00000149187] [ENSMUST00000192956]
Predicted Effect probably benign
Transcript: ENSMUST00000065941
AA Change: H211Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483
AA Change: H211Q

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080001
SMART Domains Protein: ENSMUSP00000078914
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 4 164 1.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111302
SMART Domains Protein: ENSMUSP00000106933
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 6 160 1.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
AA Change: H211Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483
AA Change: H211Q

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
AA Change: H211Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483
AA Change: H211Q

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144576
SMART Domains Protein: ENSMUSP00000137977
Gene: ENSMUSG00000062963

DomainStartEndE-ValueType
Pfam:UFC1 4 91 2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149187
AA Change: H211Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483
AA Change: H211Q

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133362
Gene: ENSMUSG00000053483
AA Change: H76Q

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
Pfam:UCH 77 162 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but develop splenomegaly, show an increased percentage of macrophages and neutrophils in spleen, and are more resistant to vesicular stomatitis virus (VSV) infection with elevated interferon production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Usp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Usp21 APN 1 171283402 missense probably damaging 0.96
IGL01726:Usp21 APN 1 171284001 missense probably damaging 1.00
IGL01915:Usp21 APN 1 171282733 missense possibly damaging 0.92
IGL02504:Usp21 APN 1 171285023 missense probably benign 0.39
IGL02646:Usp21 APN 1 171283095 unclassified probably benign
R0513:Usp21 UTSW 1 171283012 unclassified probably benign
R0513:Usp21 UTSW 1 171283014 unclassified probably benign
R0570:Usp21 UTSW 1 171283746 unclassified probably benign
R1582:Usp21 UTSW 1 171283081 missense probably damaging 1.00
R1700:Usp21 UTSW 1 171283722 missense probably damaging 1.00
R4061:Usp21 UTSW 1 171285401 unclassified probably benign
R4073:Usp21 UTSW 1 171282172 unclassified probably benign
R5914:Usp21 UTSW 1 171282171 unclassified probably benign
R6879:Usp21 UTSW 1 171282503 missense probably damaging 1.00
R7857:Usp21 UTSW 1 171286762 missense probably benign 0.27
R8356:Usp21 UTSW 1 171284717 missense probably damaging 1.00
R8456:Usp21 UTSW 1 171284717 missense probably damaging 1.00
R8539:Usp21 UTSW 1 171283673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCACGGCATTCAGGAAGC -3'
(R):5'- CAGCTGTGATGGGCTTACTACTC -3'

Sequencing Primer
(F):5'- TGGGGACACTGCTGTTACC -3'
(R):5'- GGCTTACTACTCATGACCAGTGAG -3'
Posted On2019-10-24