Incidental Mutation 'R7611:Zfhx4'
ID588582
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Namezinc finger homeodomain 4
SynonymsZfh4, C130041O22Rik, Zfh-4
Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location5218526-5415857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5403771 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 3021 (K3021N)
Ref Sequence ENSEMBL: ENSMUSP00000135827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
Predicted Effect probably damaging
Transcript: ENSMUST00000026284
AA Change: K2996N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: K2996N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175866
AA Change: K3021N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: K3021N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176383
AA Change: K2996N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: K2996N

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5242341 missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5245523 missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5245347 missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5243568 missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5413094 missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5242328 missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5244284 missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5399327 missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5401136 missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5243976 missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5399462 missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5242045 missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5244092 missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5412709 missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5244304 splice site probably null
IGL02342:Zfhx4 APN 3 5402374 missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5399603 missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5411843 missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5399183 missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5329523 missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5412153 missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5243307 missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5390408 missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5242525 missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5403914 missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5401171 missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5411780 nonsense probably null
IGL03302:Zfhx4 APN 3 5403713 missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5403350 missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5411850 missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5403385 missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5403175 missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5399539 missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5243733 missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5399588 missense probably benign 0.04
PIT4377001:Zfhx4 UTSW 3 5242742 missense probably damaging 0.98
R0090:Zfhx4 UTSW 3 5243625 missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5398982 missense probably damaging 1.00
R0401:Zfhx4 UTSW 3 5401161 missense possibly damaging 0.87
R0465:Zfhx4 UTSW 3 5245656 splice site probably benign
R0506:Zfhx4 UTSW 3 5402735 missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5400988 nonsense probably null
R0550:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5402101 missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5402633 missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5401733 missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5401073 missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5403820 missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5412212 missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5399870 missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5400831 small deletion probably benign
R1338:Zfhx4 UTSW 3 5396961 missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5401387 missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5241859 missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1552:Zfhx4 UTSW 3 5403110 missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5241729 missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5400413 missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5413016 missense probably damaging 1.00
R1717:Zfhx4 UTSW 3 5403104 missense probably benign 0.20
R1739:Zfhx4 UTSW 3 5401730 missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5382616 missense probably benign
R1842:Zfhx4 UTSW 3 5401498 missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5398927 missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5403163 missense possibly damaging 0.58
R2154:Zfhx4 UTSW 3 5401741 missense possibly damaging 0.86
R2165:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5403332 missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5242289 missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5396918 missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5397060 missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2520:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5245143 missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5403664 missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5403654 missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5399326 missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5403823 missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5403344 missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5400785 missense probably benign
R3919:Zfhx4 UTSW 3 5399115 missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5400647 missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5403847 missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5398859 missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5399324 missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5243627 missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5403345 nonsense probably null
R4439:Zfhx4 UTSW 3 5214815 unclassified probably benign
R4497:Zfhx4 UTSW 3 5399620 missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5412518 missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5401834 missense probably benign 0.00
R4612:Zfhx4 UTSW 3 5397063 missense probably damaging 1.00
R4616:Zfhx4 UTSW 3 5413067 missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5402639 missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5403476 missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5403404 missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5399281 missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5245503 unclassified probably null
R4729:Zfhx4 UTSW 3 5399497 missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5214807 unclassified probably benign
R4757:Zfhx4 UTSW 3 5400062 missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5400152 missense probably benign
R4819:Zfhx4 UTSW 3 5403914 missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5242011 missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5398979 missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5242047 missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5403641 missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5399207 missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5412425 missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5243007 missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5403138 missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5403619 missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5403321 missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5402620 missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5402659 missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5402138 missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5396970 missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5403427 missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5396959 missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5398811 missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5401951 missense probably benign
R6374:Zfhx4 UTSW 3 5244035 missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5243350 missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5413110 missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5243145 missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5242428 missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5244108 missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5241837 missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5412987 missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5403830 missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5402489 missense probably damaging 0.97
R7127:Zfhx4 UTSW 3 5413044 missense probably damaging 0.99
R7138:Zfhx4 UTSW 3 5412047 missense possibly damaging 0.69
R7161:Zfhx4 UTSW 3 5244083 missense possibly damaging 0.65
R7213:Zfhx4 UTSW 3 5396644 missense probably benign
R7483:Zfhx4 UTSW 3 5412177 missense probably damaging 0.98
R7514:Zfhx4 UTSW 3 5242207 missense possibly damaging 0.91
R7544:Zfhx4 UTSW 3 5412815 missense probably damaging 0.98
R7565:Zfhx4 UTSW 3 5390366 missense probably benign 0.04
R7640:Zfhx4 UTSW 3 5412480 missense probably benign 0.19
R7649:Zfhx4 UTSW 3 5242110 missense probably damaging 1.00
R7689:Zfhx4 UTSW 3 5411886 missense probably benign 0.05
R7711:Zfhx4 UTSW 3 5396956 missense probably damaging 0.98
R7895:Zfhx4 UTSW 3 5242199 missense probably benign 0.00
R7920:Zfhx4 UTSW 3 5400455 missense possibly damaging 0.62
R7972:Zfhx4 UTSW 3 5412473 missense probably benign 0.02
R7993:Zfhx4 UTSW 3 5412987 missense probably damaging 1.00
R8133:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R8158:Zfhx4 UTSW 3 5398950 nonsense probably null
R8272:Zfhx4 UTSW 3 5243867 missense probably damaging 0.99
R8285:Zfhx4 UTSW 3 5401856 missense probably benign 0.17
R8321:Zfhx4 UTSW 3 5401127 missense probably damaging 1.00
R8381:Zfhx4 UTSW 3 5382616 missense probably benign 0.00
RF019:Zfhx4 UTSW 3 5403267 missense probably benign 0.08
X0025:Zfhx4 UTSW 3 5411836 missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5412338 missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5402414 missense probably benign 0.13
X0028:Zfhx4 UTSW 3 5403267 missense probably damaging 1.00
X0054:Zfhx4 UTSW 3 5399710 nonsense probably null
Z1177:Zfhx4 UTSW 3 5242446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATGAGATTGGTCTGCC -3'
(R):5'- CTTGCAAGCTGATACCATGCAG -3'

Sequencing Primer
(F):5'- TCTGCCCAAACGAGTGGTG -3'
(R):5'- TGATACCATGCAGCGAGC -3'
Posted On2019-10-24