Incidental Mutation 'R7611:Cyp3a11'
ID588592
Institutional Source Beutler Lab
Gene Symbol Cyp3a11
Ensembl Gene ENSMUSG00000056035
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 11
SynonymsIIIAm1, Cyp3a, Pcn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145854426-145879964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145860381 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 396 (M396K)
Ref Sequence ENSEMBL: ENSMUSP00000037665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035918]
Predicted Effect probably benign
Transcript: ENSMUST00000035918
AA Change: M396K

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037665
Gene: ENSMUSG00000056035
AA Change: M396K

DomainStartEndE-ValueType
Pfam:p450 38 494 2.4e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Cyp3a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Cyp3a11 APN 5 145862465 missense probably damaging 1.00
IGL01316:Cyp3a11 APN 5 145855151 missense possibly damaging 0.78
IGL01348:Cyp3a11 APN 5 145869007 missense possibly damaging 0.80
IGL01591:Cyp3a11 APN 5 145875481 splice site probably benign
IGL01665:Cyp3a11 APN 5 145868665 missense probably benign 0.00
IGL02203:Cyp3a11 APN 5 145869166 missense probably damaging 1.00
IGL02894:Cyp3a11 APN 5 145869026 nonsense probably null
IGL03201:Cyp3a11 APN 5 145860379 missense possibly damaging 0.94
IGL03342:Cyp3a11 APN 5 145855117 missense probably damaging 0.96
PIT4486001:Cyp3a11 UTSW 5 145860492 missense probably damaging 0.99
R0347:Cyp3a11 UTSW 5 145865925 missense possibly damaging 0.93
R0376:Cyp3a11 UTSW 5 145862452 nonsense probably null
R0378:Cyp3a11 UTSW 5 145868607 missense probably benign 0.43
R0448:Cyp3a11 UTSW 5 145862394 missense probably benign 0.00
R0567:Cyp3a11 UTSW 5 145869149 missense probably damaging 1.00
R0968:Cyp3a11 UTSW 5 145862514 splice site probably benign
R1292:Cyp3a11 UTSW 5 145865994 missense probably benign 0.04
R1400:Cyp3a11 UTSW 5 145862489 missense probably damaging 0.98
R1478:Cyp3a11 UTSW 5 145858771 missense probably benign 0.01
R1520:Cyp3a11 UTSW 5 145862453 missense probably damaging 1.00
R1716:Cyp3a11 UTSW 5 145868966 missense probably benign
R2060:Cyp3a11 UTSW 5 145855081 missense probably benign 0.00
R2076:Cyp3a11 UTSW 5 145879766 missense probably benign
R2227:Cyp3a11 UTSW 5 145868547 missense possibly damaging 0.90
R3725:Cyp3a11 UTSW 5 145866000 missense probably benign 0.02
R4222:Cyp3a11 UTSW 5 145860466 missense probably damaging 0.99
R4256:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4294:Cyp3a11 UTSW 5 145869195 missense probably benign 0.04
R4852:Cyp3a11 UTSW 5 145860495 missense probably damaging 1.00
R5229:Cyp3a11 UTSW 5 145855135 missense probably benign 0.00
R5285:Cyp3a11 UTSW 5 145855083 missense probably benign 0.00
R5590:Cyp3a11 UTSW 5 145865977 missense probably benign 0.00
R5703:Cyp3a11 UTSW 5 145860373 missense probably benign
R5786:Cyp3a11 UTSW 5 145862474 missense possibly damaging 0.47
R6291:Cyp3a11 UTSW 5 145862427 missense possibly damaging 0.89
R6405:Cyp3a11 UTSW 5 145862420 missense probably damaging 0.96
R6892:Cyp3a11 UTSW 5 145860448 missense probably damaging 0.98
R7114:Cyp3a11 UTSW 5 145858783 missense probably benign 0.16
R7243:Cyp3a11 UTSW 5 145858803 missense probably damaging 0.96
R7438:Cyp3a11 UTSW 5 145865900 missense probably benign 0.39
R8346:Cyp3a11 UTSW 5 145858802 missense probably damaging 1.00
R8371:Cyp3a11 UTSW 5 145868628 missense possibly damaging 0.92
R8895:Cyp3a11 UTSW 5 145860520 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCACACAATGCAAATGTTTG -3'
(R):5'- TGGGGATGCTGAGAACTCAAC -3'

Sequencing Primer
(F):5'- CACACAATGCAAATGTTTGTAAAATC -3'
(R):5'- GGATGCTGAGAACTCAACACTAGAC -3'
Posted On2019-10-24