Incidental Mutation 'R7611:Capns1'
ID588599
Institutional Source Beutler Lab
Gene Symbol Capns1
Ensembl Gene ENSMUSG00000001794
Gene Namecalpain, small subunit 1
SynonymsD7Ertd146e, Capa-4, Capn4, Capa4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30186936-30198811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30190114 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 220 (E220V)
Ref Sequence ENSEMBL: ENSMUSP00000117951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001845] [ENSMUST00000098594] [ENSMUST00000108196] [ENSMUST00000126116] [ENSMUST00000208441]
Predicted Effect probably damaging
Transcript: ENSMUST00000001845
AA Change: E220V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001845
Gene: ENSMUSG00000001794
AA Change: E220V

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
EFh 238 265 6.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098594
SMART Domains Protein: ENSMUSP00000096193
Gene: ENSMUSG00000074218

DomainStartEndE-ValueType
Pfam:COX7a 23 79 1.3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108196
AA Change: E152V

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103831
Gene: ENSMUSG00000001794
AA Change: E152V

DomainStartEndE-ValueType
EFh 75 103 3.93e0 SMART
EFh 105 133 1.42e1 SMART
EFh 170 197 6.09e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126116
AA Change: E220V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117951
Gene: ENSMUSG00000001794
AA Change: E220V

DomainStartEndE-ValueType
low complexity region 10 64 N/A INTRINSIC
EFh 143 171 3.93e0 SMART
EFh 173 201 1.42e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208441
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E11.5. Mutant embryos exhibit cardiac developmental defects, reduced yolk sac vasculature, hemorrhaging in the area between the embryo and amnion, and accumulation of nucleated erythroid cells in the heart chambers, blood vessels, and developing liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Capns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Capns1 APN 7 30190140 missense probably benign 0.00
IGL01128:Capns1 APN 7 30190133 missense probably benign 0.00
IGL02175:Capns1 APN 7 30190532 missense probably benign 0.28
IGL02966:Capns1 APN 7 30192193 missense probably damaging 1.00
IGL02799:Capns1 UTSW 7 30192219 missense probably benign 0.05
R0578:Capns1 UTSW 7 30194028 unclassified probably benign
R1484:Capns1 UTSW 7 30194086 unclassified probably benign
R2153:Capns1 UTSW 7 30192340 missense probably damaging 1.00
R5111:Capns1 UTSW 7 30192519 missense probably benign
R5323:Capns1 UTSW 7 30187722 missense possibly damaging 0.85
R5350:Capns1 UTSW 7 30190126 missense probably damaging 1.00
R6684:Capns1 UTSW 7 30193899 missense probably damaging 0.98
R7573:Capns1 UTSW 7 30192535 missense probably damaging 1.00
R8828:Capns1 UTSW 7 30190538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTCTCAGCTGTCCCTG -3'
(R):5'- ACTGGAGATTGAGAAGTCCTGTG -3'

Sequencing Primer
(F):5'- TGCCTAGTGAGCCCAGCATTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTGC -3'
Posted On2019-10-24