Incidental Mutation 'R7611:Vmn2r76'
ID 588600
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Name vomeronasal 2, receptor 76
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R7611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86225206-86246201 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86230180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 304 (I304T)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
AlphaFold E9Q3F5
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: I304T

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: I304T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
R7082:Vmn2r76 UTSW 7 86225232 missense probably benign 0.01
R7136:Vmn2r76 UTSW 7 86228767 missense probably benign 0.06
R7524:Vmn2r76 UTSW 7 86225369 missense probably benign 0.22
R7524:Vmn2r76 UTSW 7 86230166 missense probably benign 0.00
R7833:Vmn2r76 UTSW 7 86228684 missense probably benign
R8002:Vmn2r76 UTSW 7 86230063 missense probably benign 0.05
R8021:Vmn2r76 UTSW 7 86225750 missense probably damaging 1.00
R8023:Vmn2r76 UTSW 7 86229820 missense probably benign 0.00
R8250:Vmn2r76 UTSW 7 86226023 missense possibly damaging 0.82
R8428:Vmn2r76 UTSW 7 86225271 missense possibly damaging 0.63
R8874:Vmn2r76 UTSW 7 86228791 missense probably damaging 1.00
R9139:Vmn2r76 UTSW 7 86229962 missense probably benign 0.02
R9357:Vmn2r76 UTSW 7 86231220 missense probably benign 0.43
Z1176:Vmn2r76 UTSW 7 86246063 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGGTTTCTGGATAACCATTTCAGC -3'
(R):5'- ATGACATCTGTTTAGCCTTTGTGAC -3'

Sequencing Primer
(F):5'- CTTGAACATGTCTTGAGACTCTTAC -3'
(R):5'- TCTGTTTAGCCTTTGTGACTATTATC -3'
Posted On 2019-10-24