Incidental Mutation 'R7611:Rsph4a'
ID588609
Institutional Source Beutler Lab
Gene Symbol Rsph4a
Ensembl Gene ENSMUSG00000039552
Gene Nameradial spoke head 4 homolog A (Chlamydomonas)
SynonymsRshl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location33905111-33916021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33905477 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 108 (P108S)
Ref Sequence ENSEMBL: ENSMUSP00000131647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169670]
Predicted Effect probably benign
Transcript: ENSMUST00000169670
AA Change: P108S

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: P108S

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
Pfam:Radial_spoke 209 695 2.7e-205 PFAM
low complexity region 702 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Rsph4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Rsph4a APN 10 33914343 missense probably damaging 1.00
IGL00536:Rsph4a APN 10 33911656 splice site probably benign
IGL00702:Rsph4a APN 10 33913072 missense probably damaging 0.99
IGL02313:Rsph4a APN 10 33905525 missense possibly damaging 0.56
IGL02556:Rsph4a APN 10 33905152 utr 5 prime probably benign
PIT4519001:Rsph4a UTSW 10 33909130 missense probably benign 0.09
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0088:Rsph4a UTSW 10 33909353 missense probably benign 0.15
R0513:Rsph4a UTSW 10 33912991 nonsense probably null
R1559:Rsph4a UTSW 10 33909731 missense probably damaging 0.99
R1589:Rsph4a UTSW 10 33905529 missense probably benign 0.01
R1783:Rsph4a UTSW 10 33911636 missense probably damaging 1.00
R1914:Rsph4a UTSW 10 33913072 missense probably damaging 0.99
R2046:Rsph4a UTSW 10 33914543 unclassified probably benign
R2280:Rsph4a UTSW 10 33911599 missense probably benign 0.00
R2496:Rsph4a UTSW 10 33908098 missense possibly damaging 0.87
R3084:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R3086:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R4519:Rsph4a UTSW 10 33911627 nonsense probably null
R4965:Rsph4a UTSW 10 33909240 missense probably damaging 1.00
R5077:Rsph4a UTSW 10 33908279 missense probably damaging 1.00
R5264:Rsph4a UTSW 10 33909383 missense probably damaging 1.00
R5359:Rsph4a UTSW 10 33908236 missense probably benign 0.08
R5464:Rsph4a UTSW 10 33909341 missense possibly damaging 0.64
R5615:Rsph4a UTSW 10 33909328 missense probably benign 0.32
R5751:Rsph4a UTSW 10 33905793 missense probably damaging 0.99
R5763:Rsph4a UTSW 10 33905688 missense probably damaging 0.98
R5832:Rsph4a UTSW 10 33909502 missense probably benign 0.01
R6243:Rsph4a UTSW 10 33909143 missense probably damaging 1.00
R6654:Rsph4a UTSW 10 33912992 missense probably benign
R6918:Rsph4a UTSW 10 33905276 missense probably benign 0.00
R7081:Rsph4a UTSW 10 33909193 missense probably damaging 0.97
R7453:Rsph4a UTSW 10 33909293 missense probably benign 0.00
R7670:Rsph4a UTSW 10 33909033 missense probably damaging 1.00
R8017:Rsph4a UTSW 10 33909459 missense probably damaging 1.00
R8495:Rsph4a UTSW 10 33905492 missense probably benign 0.00
R8806:Rsph4a UTSW 10 33909449 missense probably damaging 0.99
X0057:Rsph4a UTSW 10 33905727 missense possibly damaging 0.58
X0066:Rsph4a UTSW 10 33913009 missense possibly damaging 0.94
Z1176:Rsph4a UTSW 10 33911643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACCTGAGTACCGGGAAG -3'
(R):5'- GGTCAAATCTCAGCCCTTTGTG -3'

Sequencing Primer
(F):5'- CCTGAGTACCGGGAAGAGGAG -3'
(R):5'- AAATCTCAGCCCTTTGTGCTTGG -3'
Posted On2019-10-24