Incidental Mutation 'R7611:Mbd3'
ID588612
Institutional Source Beutler Lab
Gene Symbol Mbd3
Ensembl Gene ENSMUSG00000035478
Gene Namemethyl-CpG binding domain protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80392539-80399550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80395518 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 63 (D63G)
Ref Sequence ENSEMBL: ENSMUSP00000089948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092295] [ENSMUST00000105347] [ENSMUST00000105348] [ENSMUST00000105349]
Predicted Effect probably damaging
Transcript: ENSMUST00000092295
AA Change: D63G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089948
Gene: ENSMUSG00000035478
AA Change: D63G

DomainStartEndE-ValueType
MBD 3 76 8.9e-35 SMART
Pfam:MBDa 79 148 8.2e-32 PFAM
Pfam:MBD_C 152 243 4.7e-37 PFAM
low complexity region 268 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105347
AA Change: D39G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100984
Gene: ENSMUSG00000035478
AA Change: D39G

DomainStartEndE-ValueType
Pfam:MBD 12 48 4.4e-8 PFAM
Pfam:MBD_C 126 219 9.8e-39 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105348
AA Change: D31G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100985
Gene: ENSMUSG00000035478
AA Change: D31G

DomainStartEndE-ValueType
MBD 1 44 4.8e-6 SMART
Pfam:MBD_C 146 239 1.7e-35 PFAM
low complexity region 264 279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105349
AA Change: D31G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100986
Gene: ENSMUSG00000035478
AA Change: D31G

DomainStartEndE-ValueType
Pfam:MBD 4 40 4.7e-8 PFAM
Pfam:MBD_C 118 211 1.1e-38 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142997
SMART Domains Protein: ENSMUSP00000120675
Gene: ENSMUSG00000035478

DomainStartEndE-ValueType
Pfam:MBDa 1 48 2.4e-25 PFAM
Pfam:MBD_C 52 143 1.3e-37 PFAM
low complexity region 168 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the MBD family of nuclear proteins that contain a methyl-CpG binding domain (MBD). The encoded protein is a component of the nucleosome remodeling and histone deacetylation (NuRD) complex. Deletion of this gene causes embryonic lethality in mice. Embryonic stem cells lacking the encoded protein are severely compromised in their ability to differentiate and fail to commit to developmental lineages in the absence of leukemia inhibitory factor. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience deficiencies as embryos around implantation and die before birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Mbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mbd3 APN 10 80393883 splice site probably benign
IGL01573:Mbd3 APN 10 80393261 missense probably benign 0.03
IGL03080:Mbd3 APN 10 80393251 missense probably damaging 1.00
R1489:Mbd3 UTSW 10 80393906 missense probably damaging 1.00
R1500:Mbd3 UTSW 10 80394586 missense possibly damaging 0.90
R4454:Mbd3 UTSW 10 80393983 missense probably damaging 1.00
R4921:Mbd3 UTSW 10 80395576 missense probably damaging 1.00
R7659:Mbd3 UTSW 10 80395185 missense probably damaging 1.00
X0063:Mbd3 UTSW 10 80395453 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTAGCCAGAGCCTGAATGG -3'
(R):5'- GCCTTCCTAATGACCTGGTG -3'

Sequencing Primer
(F):5'- ATCAGGCACGGAGATCTCC -3'
(R):5'- CTTCCTAATGACCTGGTGAAAACAG -3'
Posted On2019-10-24