Incidental Mutation 'R7611:Lrriq1'
ID 588614
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 045715-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7611 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103036432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 907 (K907R)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000166240
AA Change: K907R

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: K907R

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adcy8 C T 15: 64,792,882 (GRCm39) G25S probably benign Het
Ahnak2 G T 12: 112,751,749 (GRCm39) D35E Het
Birc6 T C 17: 74,969,713 (GRCm39) M4261T probably damaging Het
Caln1 T G 5: 130,534,918 (GRCm39) F45V probably damaging Het
Camta2 A T 11: 70,572,372 (GRCm39) I313N possibly damaging Het
Capns1 T A 7: 29,889,539 (GRCm39) E220V probably damaging Het
Carmil1 C A 13: 24,197,315 (GRCm39) V1374L probably benign Het
Casp2 T G 6: 42,250,972 (GRCm39) L290R possibly damaging Het
Cdkn2b C A 4: 89,228,980 (GRCm39) V19L probably benign Het
Ces1c T C 8: 93,851,139 (GRCm39) N162D probably benign Het
Cfap96 A G 8: 46,423,488 (GRCm39) Y75H probably damaging Het
Chd9 T C 8: 91,763,017 (GRCm39) S2281P probably damaging Het
Chst13 T C 6: 90,285,999 (GRCm39) D321G probably damaging Het
Ckap2l G T 2: 129,127,600 (GRCm39) P193T possibly damaging Het
Clca4b T A 3: 144,627,757 (GRCm39) T405S probably benign Het
Cmah T C 13: 24,619,630 (GRCm39) V265A probably benign Het
Cyp3a11 A T 5: 145,797,191 (GRCm39) M396K probably benign Het
Ddr2 A T 1: 169,825,727 (GRCm39) M291K possibly damaging Het
Ddx43 T A 9: 78,309,635 (GRCm39) I145N probably benign Het
Ephb2 T A 4: 136,388,212 (GRCm39) probably null Het
Fgfr1 A T 8: 26,048,221 (GRCm39) K106* probably null Het
Gpr6 A G 10: 40,946,875 (GRCm39) F236L probably benign Het
Grin2c A G 11: 115,143,511 (GRCm39) S750P probably damaging Het
Hecw2 A G 1: 53,952,459 (GRCm39) S925P probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Hmg20b T A 10: 81,185,432 (GRCm39) probably benign Het
Kcnk10 T A 12: 98,484,899 (GRCm39) Y79F probably damaging Het
Lrrc30 A T 17: 67,939,424 (GRCm39) F52Y probably damaging Het
Mbd3 T C 10: 80,231,352 (GRCm39) D63G probably damaging Het
Mettl21a C T 1: 64,654,266 (GRCm39) A84T probably benign Het
Mmp19 A G 10: 128,634,857 (GRCm39) D491G probably benign Het
Mug1 A T 6: 121,852,387 (GRCm39) probably null Het
Myh1 A T 11: 67,101,243 (GRCm39) H673L possibly damaging Het
Nlrc5 T C 8: 95,239,276 (GRCm39) probably null Het
Nme9 T A 9: 99,352,843 (GRCm39) S264R probably benign Het
Nup153 T C 13: 46,840,798 (GRCm39) T937A probably benign Het
Obsl1 T C 1: 75,482,024 (GRCm39) E282G probably damaging Het
Or1o3 A G 17: 37,573,745 (GRCm39) V270A probably benign Het
Or2w2 A G 13: 21,758,488 (GRCm39) V46A probably benign Het
Or4l15 C A 14: 50,198,368 (GRCm39) A54S probably benign Het
Or5an10 T A 19: 12,276,242 (GRCm39) M85L probably damaging Het
Or5b99 T A 19: 12,976,431 (GRCm39) I27N possibly damaging Het
Or5m5 T A 2: 85,814,407 (GRCm39) C74* probably null Het
Or8k30 T A 2: 86,339,397 (GRCm39) I198K possibly damaging Het
Pcdhga12 T C 18: 37,901,478 (GRCm39) F770S possibly damaging Het
Pfkp T A 13: 6,655,119 (GRCm39) probably null Het
Prr29 C G 11: 106,267,158 (GRCm39) H58D probably damaging Het
Ptprz1 T A 6: 23,001,219 (GRCm39) M1103K probably benign Het
Rigi T C 4: 40,225,651 (GRCm39) E250G probably damaging Het
Rsph4a C T 10: 33,781,473 (GRCm39) P108S probably benign Het
Setd1b A C 5: 123,290,657 (GRCm39) M875L unknown Het
Slc15a2 A G 16: 36,576,673 (GRCm39) S485P probably benign Het
Smoc1 A G 12: 81,226,444 (GRCm39) D423G probably damaging Het
Spast T A 17: 74,676,198 (GRCm39) V337D probably damaging Het
Spesp1 T C 9: 62,179,987 (GRCm39) K307R possibly damaging Het
Sulf1 A G 1: 12,906,467 (GRCm39) E503G probably benign Het
Susd6 T C 12: 80,921,341 (GRCm39) Y313H probably damaging Het
Them4 A T 3: 94,238,865 (GRCm39) D224V possibly damaging Het
Tpsg1 G T 17: 25,592,184 (GRCm39) G86V probably damaging Het
Tspear A T 10: 77,717,049 (GRCm39) T575S probably benign Het
Usp21 A T 1: 171,113,142 (GRCm39) H211Q probably benign Het
Vmn1r189 T C 13: 22,286,322 (GRCm39) S172G probably benign Het
Vmn2r114 T C 17: 23,515,944 (GRCm39) S516G probably damaging Het
Vmn2r28 T A 7: 5,484,255 (GRCm39) R648S probably benign Het
Vmn2r6 C A 3: 64,472,563 (GRCm39) V53F probably damaging Het
Vmn2r76 A G 7: 85,879,388 (GRCm39) I304T probably benign Het
Vmn2r88 A C 14: 51,651,454 (GRCm39) Y256S Het
Zfhx4 A T 3: 5,468,831 (GRCm39) K3021N probably damaging Het
Zfp647 T C 15: 76,795,988 (GRCm39) H224R probably damaging Het
Zfp865 A G 7: 5,034,130 (GRCm39) E705G probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103,051,312 (GRCm39) missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAGATCAACCTAAAGTG -3'
(R):5'- CCTCTGGATAGTATAGCTATTTCCATG -3'

Sequencing Primer
(F):5'- AAAGTGCTCACGCTTGCTAC -3'
(R):5'- CTCTGCTTAGGAAAACCACA -3'
Posted On 2019-10-24