Incidental Mutation 'R7611:Vmn1r189'
ID588626
Institutional Source Beutler Lab
Gene Symbol Vmn1r189
Ensembl Gene ENSMUSG00000099611
Gene Namevomeronasal 1 receptor 189
SynonymsV1rh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22099762-22105824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22102152 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 172 (S172G)
Ref Sequence ENSEMBL: ENSMUSP00000140924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186062] [ENSMUST00000227357] [ENSMUST00000228428]
Predicted Effect probably benign
Transcript: ENSMUST00000186062
AA Change: S172G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140924
Gene: ENSMUSG00000099611
AA Change: S172G

DomainStartEndE-ValueType
Pfam:7tm_1 30 283 1e-7 PFAM
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227357
AA Change: S172G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228428
AA Change: S172G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Vmn1r189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03084:Vmn1r189 APN 13 22101838 nonsense probably null
R0437:Vmn1r189 UTSW 13 22102061 missense probably damaging 0.99
R1199:Vmn1r189 UTSW 13 22102658 missense probably damaging 0.99
R1795:Vmn1r189 UTSW 13 22102154 missense probably benign 0.03
R2251:Vmn1r189 UTSW 13 22102548 missense probably damaging 1.00
R3751:Vmn1r189 UTSW 13 22102212 missense probably benign 0.00
R3824:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3825:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3856:Vmn1r189 UTSW 13 22102269 missense possibly damaging 0.56
R4688:Vmn1r189 UTSW 13 22102119 missense probably damaging 0.99
R5665:Vmn1r189 UTSW 13 22102166 missense probably damaging 1.00
R5778:Vmn1r189 UTSW 13 22102382 missense probably damaging 0.99
R6149:Vmn1r189 UTSW 13 22101884 missense probably benign 0.33
R6431:Vmn1r189 UTSW 13 22102355 missense probably damaging 0.98
R6660:Vmn1r189 UTSW 13 22101896 missense possibly damaging 0.89
R6974:Vmn1r189 UTSW 13 22102458 missense probably damaging 1.00
R7051:Vmn1r189 UTSW 13 22102115 missense possibly damaging 0.58
R7269:Vmn1r189 UTSW 13 22102567 missense probably benign 0.00
R7330:Vmn1r189 UTSW 13 22102541 missense possibly damaging 0.95
R7894:Vmn1r189 UTSW 13 22101736 nonsense probably null
R8214:Vmn1r189 UTSW 13 22102131 missense probably benign 0.01
Z1177:Vmn1r189 UTSW 13 22101883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGGAGGACACTTTGAGC -3'
(R):5'- CAGGCCATCATCATCAGTCC -3'

Sequencing Primer
(F):5'- AGGACACTTTGAGCAGCTCTC -3'
(R):5'- TCATCAGTCCCAGAGCATCTG -3'
Posted On2019-10-24