Incidental Mutation 'R7611:Olfr724'
ID588630
Institutional Source Beutler Lab
Gene Symbol Olfr724
Ensembl Gene ENSMUSG00000096254
Gene Nameolfactory receptor 724
SynonymsGA_x6K02T2PMLR-5645801-5644872, MOR247-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location49960023-49963274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49960911 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 54 (A54S)
Ref Sequence ENSEMBL: ENSMUSP00000149110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075030] [ENSMUST00000213390]
Predicted Effect probably benign
Transcript: ENSMUST00000075030
AA Change: A54S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074546
Gene: ENSMUSG00000096254
AA Change: A54S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7TM_GPCR_Srsx 34 302 3e-11 PFAM
Pfam:7tm_1 41 287 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213390
AA Change: A54S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Olfr724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02811:Olfr724 APN 14 49960133 utr 3 prime probably benign
R0829:Olfr724 UTSW 14 49961046 missense probably benign 0.03
R1513:Olfr724 UTSW 14 49961101 critical splice acceptor site probably null
R2016:Olfr724 UTSW 14 49960502 missense probably benign 0.00
R2936:Olfr724 UTSW 14 49960154 missense probably benign 0.03
R3082:Olfr724 UTSW 14 49960704 missense probably damaging 1.00
R3738:Olfr724 UTSW 14 49960556 missense possibly damaging 0.60
R4772:Olfr724 UTSW 14 49960995 small deletion probably benign
R4830:Olfr724 UTSW 14 49960224 missense probably damaging 1.00
R4839:Olfr724 UTSW 14 49960189 missense probably benign 0.41
R5362:Olfr724 UTSW 14 49960529 missense possibly damaging 0.95
R5695:Olfr724 UTSW 14 49960623 missense probably benign 0.00
R6187:Olfr724 UTSW 14 49961069 start codon destroyed probably null 0.99
R7371:Olfr724 UTSW 14 49961106 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAAGGGTCATTTCAGCACCCC -3'
(R):5'- GCTTGCTTTCAAATCATTACTTAGC -3'

Sequencing Primer
(F):5'- GCAGCCCTGAAAAGAGAT -3'
(R):5'- ACATACTGATACTTACTGTAACTTGC -3'
Posted On2019-10-24