Incidental Mutation 'R7611:Vmn2r88'
ID588631
Institutional Source Beutler Lab
Gene Symbol Vmn2r88
Ensembl Gene ENSMUSG00000000606
Gene Namevomeronasal 2, receptor 88
SynonymsV2r3, V2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location51410819-51419527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 51413997 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 256 (Y256S)
Ref Sequence ENSEMBL: ENSMUSP00000125126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]
Predicted Effect probably damaging
Transcript: ENSMUST00000022438
AA Change: Y264S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: Y264S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 457 8.3e-27 PFAM
Pfam:NCD3G 516 570 1.2e-18 PFAM
Pfam:7tm_3 603 838 1.9e-55 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: Y256S

DomainStartEndE-ValueType
Pfam:ANF_receptor 30 408 3.2e-30 PFAM
Pfam:NCD3G 463 516 1.2e-19 PFAM
Pfam:7tm_3 546 785 3.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: Y231S

DomainStartEndE-ValueType
Pfam:ANF_receptor 52 399 3.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228139
AA Change: Y256S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Vmn2r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r88 APN 14 51413125 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413060 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51413256 missense probably benign 0.00
IGL00990:Vmn2r88 APN 14 51416802 missense possibly damaging 0.59
IGL02308:Vmn2r88 APN 14 51417980 missense possibly damaging 0.96
IGL02481:Vmn2r88 APN 14 51414154 missense probably benign
IGL02483:Vmn2r88 APN 14 51414154 missense probably benign
IGL03241:Vmn2r88 APN 14 51418373 missense probably benign 0.03
R0052:Vmn2r88 UTSW 14 51418700 missense possibly damaging 0.88
R0070:Vmn2r88 UTSW 14 51414140 missense probably benign 0.08
R0799:Vmn2r88 UTSW 14 51414502 missense possibly damaging 0.61
R0906:Vmn2r88 UTSW 14 51418209 missense probably damaging 1.00
R1322:Vmn2r88 UTSW 14 51414108 missense probably damaging 1.00
R1352:Vmn2r88 UTSW 14 51418550 missense probably damaging 1.00
R1639:Vmn2r88 UTSW 14 51416787 missense probably damaging 0.98
R1780:Vmn2r88 UTSW 14 51418572 missense probably damaging 1.00
R1834:Vmn2r88 UTSW 14 51413030 splice site probably benign
R1911:Vmn2r88 UTSW 14 51418214 missense probably damaging 1.00
R2113:Vmn2r88 UTSW 14 51418194 missense probably damaging 1.00
R2120:Vmn2r88 UTSW 14 51413208 missense probably benign 0.00
R2126:Vmn2r88 UTSW 14 51413807 missense probably benign 0.01
R2348:Vmn2r88 UTSW 14 51414004 missense probably benign 0.00
R2881:Vmn2r88 UTSW 14 51418689 missense probably damaging 0.97
R2884:Vmn2r88 UTSW 14 51413934 missense probably damaging 1.00
R3081:Vmn2r88 UTSW 14 51418632 missense probably damaging 0.99
R3933:Vmn2r88 UTSW 14 51413978 missense probably benign 0.44
R3967:Vmn2r88 UTSW 14 51413190 missense probably benign 0.06
R4091:Vmn2r88 UTSW 14 51415426 missense probably damaging 1.00
R4378:Vmn2r88 UTSW 14 51413289 nonsense probably null
R4397:Vmn2r88 UTSW 14 51417978 missense probably damaging 1.00
R4418:Vmn2r88 UTSW 14 51418081 missense probably damaging 1.00
R4609:Vmn2r88 UTSW 14 51418074 missense probably damaging 0.98
R4647:Vmn2r88 UTSW 14 51418793 missense probably benign 0.02
R4672:Vmn2r88 UTSW 14 51418155 missense probably damaging 1.00
R4684:Vmn2r88 UTSW 14 51413334 missense possibly damaging 0.95
R4686:Vmn2r88 UTSW 14 51413339 missense probably benign 0.03
R4720:Vmn2r88 UTSW 14 51413245 missense probably benign 0.01
R5046:Vmn2r88 UTSW 14 51413181 missense probably benign 0.03
R5063:Vmn2r88 UTSW 14 51411146 missense probably damaging 0.96
R5619:Vmn2r88 UTSW 14 51413910 missense probably damaging 0.99
R5652:Vmn2r88 UTSW 14 51418572 missense probably damaging 0.98
R6020:Vmn2r88 UTSW 14 51418149 nonsense probably null
R6103:Vmn2r88 UTSW 14 51415369 missense probably benign 0.17
R6674:Vmn2r88 UTSW 14 51414338 missense probably benign 0.01
R6799:Vmn2r88 UTSW 14 51413969 missense probably benign 0.05
R7089:Vmn2r88 UTSW 14 51418643 missense
R7104:Vmn2r88 UTSW 14 51413796 missense
R7265:Vmn2r88 UTSW 14 51418319 missense
R7316:Vmn2r88 UTSW 14 51414255 missense
R7552:Vmn2r88 UTSW 14 51410858 splice site probably null
R7667:Vmn2r88 UTSW 14 51417989 missense
R7682:Vmn2r88 UTSW 14 51418449 missense
R7755:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7811:Vmn2r88 UTSW 14 51418703 missense
R7882:Vmn2r88 UTSW 14 51413046 missense probably benign 0.00
R7957:Vmn2r88 UTSW 14 51413132 missense
R7998:Vmn2r88 UTSW 14 51414108 missense
R8142:Vmn2r88 UTSW 14 51414107 missense
R8186:Vmn2r88 UTSW 14 51418700 missense
R8348:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8448:Vmn2r88 UTSW 14 51418796 missense probably damaging 0.97
R8483:Vmn2r88 UTSW 14 51413073 missense possibly damaging 0.48
R8783:Vmn2r88 UTSW 14 51414066 missense
R8859:Vmn2r88 UTSW 14 51418806 missense probably damaging 0.97
R8916:Vmn2r88 UTSW 14 51411136 missense
R8936:Vmn2r88 UTSW 14 51418526 missense possibly damaging 0.88
V5622:Vmn2r88 UTSW 14 51413127 missense probably benign
X0024:Vmn2r88 UTSW 14 51413832 missense possibly damaging 0.79
X0025:Vmn2r88 UTSW 14 51416802 missense possibly damaging 0.59
Z1177:Vmn2r88 UTSW 14 51418046 frame shift probably null
Z1177:Vmn2r88 UTSW 14 51418187 missense
Z1190:Vmn2r88 UTSW 14 51413201 missense
Predicted Primers PCR Primer
(F):5'- ACATTTGTCCCATGGCATTGTC -3'
(R):5'- GCGGTGTGCAAAAGTAATAGTC -3'

Sequencing Primer
(F):5'- CATGGCATTGTCTCCTTGATG -3'
(R):5'- CGGTGTGCAAAAGTAATAGTCCCATG -3'
Posted On2019-10-24