Incidental Mutation 'R7611:Vmn2r114'
ID588635
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Namevomeronasal 2, receptor 114
SynonymsEG666002
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23290934-23312313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23296970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 516 (S516G)
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
Predicted Effect probably damaging
Transcript: ENSMUST00000168033
AA Change: S516G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: S516G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23291665 missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23290965 missense probably benign
IGL00990:Vmn2r114 APN 17 23290983 missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23291238 missense probably damaging 1.00
IGL01838:Vmn2r114 APN 17 23296982 missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23310381 missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23310477 missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23291808 missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23311134 missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23310520 missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23291289 missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23296996 splice site probably benign
IGL03325:Vmn2r114 APN 17 23291678 missense probably damaging 1.00
BB004:Vmn2r114 UTSW 17 23291645 missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23310575 nonsense probably null
R0164:Vmn2r114 UTSW 17 23309826 critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23290943 missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23290932 makesense probably null
R0677:Vmn2r114 UTSW 17 23310594 missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23290932 makesense probably null
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23310340 missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23290932 makesense probably null
R1347:Vmn2r114 UTSW 17 23290932 makesense probably null
R1435:Vmn2r114 UTSW 17 23290932 makesense probably null
R1437:Vmn2r114 UTSW 17 23291211 missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23291701 missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23296988 missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23308061 missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23311112 missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23291109 missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23290932 makesense probably null
R2113:Vmn2r114 UTSW 17 23290932 makesense probably null
R2134:Vmn2r114 UTSW 17 23291763 missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23290932 makesense probably null
R2424:Vmn2r114 UTSW 17 23296868 missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23290932 makesense probably null
R3017:Vmn2r114 UTSW 17 23290932 makesense probably null
R3018:Vmn2r114 UTSW 17 23290932 makesense probably null
R3019:Vmn2r114 UTSW 17 23290932 makesense probably null
R3020:Vmn2r114 UTSW 17 23290932 makesense probably null
R3021:Vmn2r114 UTSW 17 23290932 makesense probably null
R4628:Vmn2r114 UTSW 17 23290932 makesense probably null
R4668:Vmn2r114 UTSW 17 23310473 missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23291379 missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23291791 missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23291658 missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23290932 makesense probably null
R5405:Vmn2r114 UTSW 17 23290932 makesense probably null
R5449:Vmn2r114 UTSW 17 23290932 makesense probably null
R5615:Vmn2r114 UTSW 17 23290932 makesense probably null
R5834:Vmn2r114 UTSW 17 23310625 missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23291295 missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23290980 missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23309965 missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23291668 missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23310246 missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23309876 missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23310202 missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23291130 missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23310163 missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23290960 missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23291494 missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23308061 missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23310637 missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23291026 missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23291265 missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23291843 nonsense probably null
R7641:Vmn2r114 UTSW 17 23308203 missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23291012 nonsense probably null
R7970:Vmn2r114 UTSW 17 23311212 missense probably benign 0.00
R8737:Vmn2r114 UTSW 17 23310168 missense probably benign 0.36
R8802:Vmn2r114 UTSW 17 23309862 missense possibly damaging 0.65
R8847:Vmn2r114 UTSW 17 23310012 missense probably damaging 1.00
X0065:Vmn2r114 UTSW 17 23310957 missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23290932 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGTGTGCCACTTACTATG -3'
(R):5'- TCACACAGGAGGCTTTCATG -3'

Sequencing Primer
(F):5'- GTGCCACTTACTATGAATTTTCAAGG -3'
(R):5'- TGGAAACAAGTCAACTTTTCCTC -3'
Posted On2019-10-24