Incidental Mutation 'R7611:Tpsg1'
ID588636
Institutional Source Beutler Lab
Gene Symbol Tpsg1
Ensembl Gene ENSMUSG00000033200
Gene Nametryptase gamma 1
SynonymsTMT, Prss31
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7611 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25369273-25374442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25373210 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 86 (G86V)
Ref Sequence ENSEMBL: ENSMUSP00000024999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024999] [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000160377] [ENSMUST00000160485] [ENSMUST00000160920] [ENSMUST00000162021]
Predicted Effect probably damaging
Transcript: ENSMUST00000024999
AA Change: G86V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024999
Gene: ENSMUSG00000033200
AA Change: G86V

DomainStartEndE-ValueType
Tryp_SPc 29 257 1.06e-87 SMART
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078496
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159610
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160377
SMART Domains Protein: ENSMUSP00000124008
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160485
SMART Domains Protein: ENSMUSP00000124721
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160920
AA Change: G13V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123828
Gene: ENSMUSG00000033200
AA Change: G13V

DomainStartEndE-ValueType
Tryp_SPc 1 184 7.18e-44 SMART
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161035
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Predicted Effect probably benign
Transcript: ENSMUST00000162021
SMART Domains Protein: ENSMUSP00000125180
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 5 111 2.35e-4 SMART
transmembrane domain 128 150 N/A INTRINSIC
Meta Mutation Damage Score 0.5691 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. There is uncertainty regarding the number of genes in this cluster. Currently four functional genes - alpha I, beta I, beta II and gamma I - have been identified. And beta I has an allelic variant named alpha II, beta II has an allelic variant beta III, also gamma I has an allelic variant gamma II. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha-tryptases predominant. This gene differs from other members of the tryptase gene family in that it has C-terminal hydrophobic domain, which may serve as a membrane anchor. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,970,451 Y75H probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy8 C T 15: 64,921,033 G25S probably benign Het
Ahnak2 G T 12: 112,788,129 D35E Het
Birc6 T C 17: 74,662,718 M4261T probably damaging Het
Caln1 T G 5: 130,506,077 F45V probably damaging Het
Camta2 A T 11: 70,681,546 I313N possibly damaging Het
Capns1 T A 7: 30,190,114 E220V probably damaging Het
Carmil1 C A 13: 24,013,332 V1374L probably benign Het
Casp2 T G 6: 42,274,038 L290R possibly damaging Het
Cdkn2b C A 4: 89,310,743 V19L probably benign Het
Ces1c T C 8: 93,124,511 N162D probably benign Het
Chd9 T C 8: 91,036,389 S2281P probably damaging Het
Chst13 T C 6: 90,309,017 D321G probably damaging Het
Ckap2l G T 2: 129,285,680 P193T possibly damaging Het
Clca4b T A 3: 144,921,996 T405S probably benign Het
Cmah T C 13: 24,435,647 V265A probably benign Het
Cyp3a11 A T 5: 145,860,381 M396K probably benign Het
Ddr2 A T 1: 169,998,158 M291K possibly damaging Het
Ddx43 T A 9: 78,402,353 I145N probably benign Het
Ddx58 T C 4: 40,225,651 E250G probably damaging Het
Ephb2 T A 4: 136,660,901 probably null Het
Fgfr1 A T 8: 25,558,205 K106* probably null Het
Gpr6 A G 10: 41,070,879 F236L probably benign Het
Grin2c A G 11: 115,252,685 S750P probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Hmg20b T A 10: 81,349,598 probably benign Het
Kcnk10 T A 12: 98,518,640 Y79F probably damaging Het
Lrrc30 A T 17: 67,632,429 F52Y probably damaging Het
Lrriq1 T C 10: 103,200,571 K907R possibly damaging Het
Mbd3 T C 10: 80,395,518 D63G probably damaging Het
Mettl21a C T 1: 64,615,107 A84T probably benign Het
Mmp19 A G 10: 128,798,988 D491G probably benign Het
Mug1 A T 6: 121,875,428 probably null Het
Myh1 A T 11: 67,210,417 H673L possibly damaging Het
Nlrc5 T C 8: 94,512,648 probably null Het
Nme9 T A 9: 99,470,790 S264R probably benign Het
Nup153 T C 13: 46,687,322 T937A probably benign Het
Obsl1 T C 1: 75,505,380 E282G probably damaging Het
Olfr1030 T A 2: 85,984,063 C74* probably null Het
Olfr1076 T A 2: 86,509,053 I198K possibly damaging Het
Olfr1364 A G 13: 21,574,318 V46A probably benign Het
Olfr1436 T A 19: 12,298,878 M85L probably damaging Het
Olfr1451 T A 19: 12,999,067 I27N possibly damaging Het
Olfr724 C A 14: 49,960,911 A54S probably benign Het
Olfr98 A G 17: 37,262,854 V270A probably benign Het
Pcdhga12 T C 18: 37,768,425 F770S possibly damaging Het
Pfkp T A 13: 6,605,083 probably null Het
Prr29 C G 11: 106,376,332 H58D probably damaging Het
Ptprz1 T A 6: 23,001,220 M1103K probably benign Het
Rsph4a C T 10: 33,905,477 P108S probably benign Het
Setd1b A C 5: 123,152,594 M875L unknown Het
Slc15a2 A G 16: 36,756,311 S485P probably benign Het
Smoc1 A G 12: 81,179,670 D423G probably damaging Het
Spast T A 17: 74,369,203 V337D probably damaging Het
Spesp1 T C 9: 62,272,705 K307R possibly damaging Het
Sulf1 A G 1: 12,836,243 E503G probably benign Het
Susd6 T C 12: 80,874,567 Y313H probably damaging Het
Them4 A T 3: 94,331,558 D224V possibly damaging Het
Tspear A T 10: 77,881,215 T575S probably benign Het
Usp21 A T 1: 171,285,569 H211Q probably benign Het
Vmn1r189 T C 13: 22,102,152 S172G probably benign Het
Vmn2r114 T C 17: 23,296,970 S516G probably damaging Het
Vmn2r28 T A 7: 5,481,256 R648S probably benign Het
Vmn2r6 C A 3: 64,565,142 V53F probably damaging Het
Vmn2r76 A G 7: 86,230,180 I304T probably benign Het
Vmn2r88 A C 14: 51,413,997 Y256S Het
Zfhx4 A T 3: 5,403,771 K3021N probably damaging Het
Zfp647 T C 15: 76,911,788 H224R probably damaging Het
Zfp865 A G 7: 5,031,131 E705G probably damaging Het
Other mutations in Tpsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tpsg1 APN 17 25373222 missense probably benign 0.36
IGL01445:Tpsg1 APN 17 25372498 nonsense probably null
IGL01515:Tpsg1 APN 17 25373962 missense probably damaging 1.00
BB010:Tpsg1 UTSW 17 25373204 missense probably damaging 0.99
BB020:Tpsg1 UTSW 17 25373204 missense probably damaging 0.99
R0095:Tpsg1 UTSW 17 25372554 missense probably damaging 1.00
R1155:Tpsg1 UTSW 17 25373794 missense possibly damaging 0.71
R1911:Tpsg1 UTSW 17 25373400 missense probably benign 0.01
R2103:Tpsg1 UTSW 17 25373293 missense possibly damaging 0.92
R2280:Tpsg1 UTSW 17 25374042 missense probably damaging 1.00
R4843:Tpsg1 UTSW 17 25370617 start gained probably benign
R6142:Tpsg1 UTSW 17 25372486 missense probably benign
R6381:Tpsg1 UTSW 17 25372569 missense probably damaging 1.00
R6597:Tpsg1 UTSW 17 25369297 unclassified probably benign
R7365:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7367:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7603:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7604:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7607:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7609:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7610:Tpsg1 UTSW 17 25373210 missense probably damaging 1.00
R7933:Tpsg1 UTSW 17 25373204 missense probably damaging 0.99
R8174:Tpsg1 UTSW 17 25372590 missense probably damaging 1.00
R8364:Tpsg1 UTSW 17 25374256 missense possibly damaging 0.68
R8685:Tpsg1 UTSW 17 25373267 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCTGTTCTTGGGCCCTTAC -3'
(R):5'- ATCCCAGGGTAGAAGTCAGCTG -3'

Sequencing Primer
(F):5'- CCAGGTTCAGGCTTTATGTACGC -3'
(R):5'- TAGAAGTCAGCTGAGGCCTCTG -3'
Posted On2019-10-24