Incidental Mutation 'R7612:Uggt1'
ID 588645
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene Name UDP-glucose glycoprotein glucosyltransferase 1
Synonyms Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission 045680-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.554) question?
Stock # R7612 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 36140027-36244720 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36163235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1094 (I1094V)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]
AlphaFold Q6P5E4
Predicted Effect probably damaging
Transcript: ENSMUST00000046875
AA Change: I1094V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: I1094V

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173166
Predicted Effect probably benign
Transcript: ENSMUST00000174224
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 (GRCm38) Y181* probably null Het
Adgrf2 T G 17: 42,714,380 (GRCm38) K71T possibly damaging Het
Brca2 T A 5: 150,540,611 (GRCm38) M1280K probably benign Het
Card14 T C 11: 119,333,579 (GRCm38) S541P possibly damaging Het
Cd19 G T 7: 126,414,324 (GRCm38) Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 (GRCm38) I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 (GRCm38) I290L probably benign Het
Cpsf1 C T 15: 76,597,009 (GRCm38) V1216I probably benign Het
Csad G A 15: 102,188,922 (GRCm38) probably benign Het
Depdc7 T A 2: 104,730,508 (GRCm38) Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 (GRCm38) S105T probably benign Het
Dsg4 C A 18: 20,470,990 (GRCm38) P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 (GRCm38) Y179N possibly damaging Het
Egfr A T 11: 16,859,025 (GRCm38) N73I possibly damaging Het
Eya2 T C 2: 165,687,737 (GRCm38) probably null Het
Fubp1 A G 3: 152,218,015 (GRCm38) Q123R possibly damaging Het
Galns A G 8: 122,584,954 (GRCm38) I439T possibly damaging Het
Gm57858 A T 3: 36,025,357 (GRCm38) S261R possibly damaging Het
Gsdmd T G 15: 75,864,954 (GRCm38) L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 (GRCm38) V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 (GRCm38) M371K probably benign Het
Kalrn G A 16: 34,314,212 (GRCm38) T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 (GRCm38) Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 (GRCm38) S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 (GRCm38) M376V probably benign Het
Mgat4e T C 1: 134,542,007 (GRCm38) T100A probably damaging Het
Myo18b T A 5: 112,865,302 (GRCm38) T812S possibly damaging Het
Nanp T A 2: 151,039,238 (GRCm38) E30V probably null Het
Olfr1369-ps1 G T 13: 21,116,047 (GRCm38) M118I probably damaging Het
Or4c107 T G 2: 88,958,505 (GRCm38) L13R probably damaging Het
Or5ac21 A T 16: 59,303,627 (GRCm38) H158L probably damaging Het
Parp3 T A 9: 106,474,194 (GRCm38) N241I probably benign Het
Piezo2 T C 18: 63,042,539 (GRCm38) N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 (GRCm38) N137S probably damaging Het
Ptgdr A G 14: 44,858,637 (GRCm38) M206T probably damaging Het
Ptprd T C 4: 76,086,459 (GRCm38) T20A probably benign Het
Rexo1 G C 10: 80,549,663 (GRCm38) S520R probably benign Het
Sgip1 T A 4: 102,869,808 (GRCm38) S94T probably benign Het
Slc35e3 A G 10: 117,740,880 (GRCm38) V182A probably benign Het
Slfn2 A G 11: 83,070,263 (GRCm38) E356G probably damaging Het
Spry4 C A 18: 38,589,929 (GRCm38) K260N probably damaging Het
Sync A T 4: 129,293,582 (GRCm38) M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 (GRCm38) V425A probably benign Het
Trim21 T A 7: 102,559,535 (GRCm38) M326L probably benign Het
Trim62 A G 4: 128,896,884 (GRCm38) Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 (GRCm38) K663M probably damaging Het
Urb1 A G 16: 90,797,910 (GRCm38) S245P probably damaging Het
Vwa3a A T 7: 120,752,615 (GRCm38) D34V probably null Het
Zbtb45 C T 7: 13,007,399 (GRCm38) A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 (GRCm38) S135P unknown Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36,179,552 (GRCm38) splice site probably benign
IGL00817:Uggt1 APN 1 36,185,932 (GRCm38) missense probably benign 0.03
IGL01395:Uggt1 APN 1 36,155,077 (GRCm38) missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36,182,474 (GRCm38) missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36,161,694 (GRCm38) missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36,176,794 (GRCm38) missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36,184,484 (GRCm38) missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36,164,519 (GRCm38) makesense probably null
IGL02346:Uggt1 APN 1 36,179,670 (GRCm38) missense probably benign 0.00
IGL02447:Uggt1 APN 1 36,150,142 (GRCm38) missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36,177,615 (GRCm38) missense probably benign 0.03
IGL02930:Uggt1 APN 1 36,157,456 (GRCm38) missense probably benign 0.01
IGL03153:Uggt1 APN 1 36,202,818 (GRCm38) missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36,207,956 (GRCm38) missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36,163,261 (GRCm38) missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36,150,048 (GRCm38) missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36,162,353 (GRCm38) missense probably benign 0.37
R0037:Uggt1 UTSW 1 36,185,932 (GRCm38) missense probably benign 0.03
R0037:Uggt1 UTSW 1 36,185,932 (GRCm38) missense probably benign 0.03
R0167:Uggt1 UTSW 1 36,170,197 (GRCm38) critical splice donor site probably null
R0373:Uggt1 UTSW 1 36,179,670 (GRCm38) missense probably benign 0.00
R0502:Uggt1 UTSW 1 36,159,946 (GRCm38) missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36,195,971 (GRCm38) missense probably benign 0.00
R0610:Uggt1 UTSW 1 36,165,506 (GRCm38) splice site probably benign
R0671:Uggt1 UTSW 1 36,155,128 (GRCm38) missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36,161,724 (GRCm38) missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36,158,143 (GRCm38) missense probably benign 0.01
R0827:Uggt1 UTSW 1 36,156,313 (GRCm38) critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36,175,078 (GRCm38) missense probably benign 0.00
R1112:Uggt1 UTSW 1 36,173,546 (GRCm38) missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36,176,796 (GRCm38) missense probably benign 0.13
R1470:Uggt1 UTSW 1 36,176,796 (GRCm38) missense probably benign 0.13
R1592:Uggt1 UTSW 1 36,202,858 (GRCm38) missense probably benign 0.04
R1730:Uggt1 UTSW 1 36,221,261 (GRCm38) missense probably benign 0.05
R1923:Uggt1 UTSW 1 36,179,613 (GRCm38) missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36,151,781 (GRCm38) missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36,192,414 (GRCm38) missense probably null 1.00
R2829:Uggt1 UTSW 1 36,162,294 (GRCm38) missense probably benign 0.38
R3431:Uggt1 UTSW 1 36,210,059 (GRCm38) nonsense probably null
R3432:Uggt1 UTSW 1 36,210,059 (GRCm38) nonsense probably null
R3725:Uggt1 UTSW 1 36,182,507 (GRCm38) nonsense probably null
R3880:Uggt1 UTSW 1 36,176,804 (GRCm38) intron probably benign
R4052:Uggt1 UTSW 1 36,164,489 (GRCm38) missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36,158,159 (GRCm38) missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36,146,668 (GRCm38) nonsense probably null
R4570:Uggt1 UTSW 1 36,150,073 (GRCm38) missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36,202,855 (GRCm38) nonsense probably null
R4895:Uggt1 UTSW 1 36,156,264 (GRCm38) missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36,202,855 (GRCm38) nonsense probably null
R5372:Uggt1 UTSW 1 36,244,060 (GRCm38) splice site probably benign
R5385:Uggt1 UTSW 1 36,184,412 (GRCm38) missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36,216,153 (GRCm38) nonsense probably null
R5694:Uggt1 UTSW 1 36,179,656 (GRCm38) missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36,161,771 (GRCm38) splice site probably null
R5893:Uggt1 UTSW 1 36,227,628 (GRCm38) splice site probably null
R6191:Uggt1 UTSW 1 36,162,208 (GRCm38) missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36,163,228 (GRCm38) missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36,234,916 (GRCm38) missense probably benign 0.00
R6399:Uggt1 UTSW 1 36,163,366 (GRCm38) missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36,174,951 (GRCm38) missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36,173,450 (GRCm38) missense probably benign 0.00
R6788:Uggt1 UTSW 1 36,230,688 (GRCm38) missense probably benign 0.00
R7165:Uggt1 UTSW 1 36,155,107 (GRCm38) missense probably benign 0.41
R7255:Uggt1 UTSW 1 36,146,106 (GRCm38) missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36,162,221 (GRCm38) missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36,151,733 (GRCm38) missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36,164,508 (GRCm38) missense probably benign 0.01
R7570:Uggt1 UTSW 1 36,185,838 (GRCm38) missense probably benign 0.09
R7759:Uggt1 UTSW 1 36,146,725 (GRCm38) missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36,207,984 (GRCm38) missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36,163,315 (GRCm38) missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36,156,258 (GRCm38) missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36,208,034 (GRCm38) missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36,211,473 (GRCm38) missense possibly damaging 0.70
R8093:Uggt1 UTSW 1 36,227,485 (GRCm38) missense probably damaging 1.00
R8245:Uggt1 UTSW 1 36,165,564 (GRCm38) missense probably damaging 1.00
R8338:Uggt1 UTSW 1 36,227,521 (GRCm38) missense probably damaging 1.00
R8353:Uggt1 UTSW 1 36,170,296 (GRCm38) critical splice acceptor site probably null
R8442:Uggt1 UTSW 1 36,173,487 (GRCm38) missense probably damaging 0.99
R8519:Uggt1 UTSW 1 36,176,643 (GRCm38) splice site probably null
R8529:Uggt1 UTSW 1 36,184,432 (GRCm38) missense possibly damaging 0.85
R8730:Uggt1 UTSW 1 36,197,543 (GRCm38) critical splice donor site probably null
R8917:Uggt1 UTSW 1 36,146,654 (GRCm38) missense
R8947:Uggt1 UTSW 1 36,158,148 (GRCm38) missense probably benign 0.12
R9240:Uggt1 UTSW 1 36,182,615 (GRCm38) missense possibly damaging 0.50
R9248:Uggt1 UTSW 1 36,210,022 (GRCm38) missense possibly damaging 0.80
R9401:Uggt1 UTSW 1 36,216,131 (GRCm38) critical splice donor site probably null
R9414:Uggt1 UTSW 1 36,184,426 (GRCm38) missense probably benign 0.01
R9416:Uggt1 UTSW 1 36,164,522 (GRCm38) missense
R9441:Uggt1 UTSW 1 36,221,225 (GRCm38) missense probably benign 0.02
R9489:Uggt1 UTSW 1 36,234,805 (GRCm38) critical splice donor site probably null
R9563:Uggt1 UTSW 1 36,165,546 (GRCm38) missense possibly damaging 0.60
R9605:Uggt1 UTSW 1 36,234,805 (GRCm38) critical splice donor site probably null
X0022:Uggt1 UTSW 1 36,165,555 (GRCm38) missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36,174,191 (GRCm38) missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36,161,695 (GRCm38) missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36,155,073 (GRCm38) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATAAAGCAGCTGCCGTAAG -3'
(R):5'- GCTGAGACTGCATCAAGAAATACC -3'

Sequencing Primer
(F):5'- CGTAAGGGAGCATCAACGTAAGG -3'
(R):5'- ATACCTAACTAACACTTGCGTTTC -3'
Posted On 2019-10-24