Incidental Mutation 'R7612:Olfr1212'
ID 588649
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Name olfactory receptor 1212
Synonyms GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7612 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88953969-88961313 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 88958505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 13 (L13R)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
AlphaFold Q7TR08
Predicted Effect probably damaging
Transcript: ENSMUST00000055895
AA Change: L13R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: L13R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215781
AA Change: L13R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2418:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R3781:Olfr1212 UTSW 2 88958747 nonsense probably null
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4440:Olfr1212 UTSW 2 88959341 missense probably benign 0.22
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7972:Olfr1212 UTSW 2 88958833 nonsense probably null
R8422:Olfr1212 UTSW 2 88958997 missense probably benign 0.05
R9111:Olfr1212 UTSW 2 88958711 missense probably benign 0.00
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTGCATATCAGTACACATGTCTG -3'
(R):5'- AATGCATGCATCCAGGAAGG -3'

Sequencing Primer
(F):5'- CAGAGTAGAGACAATGTTGTTCCTGC -3'
(R):5'- TCCAGGAAGGACAGAAATGCC -3'
Posted On 2019-10-24