Incidental Mutation 'R7612:Hcrtr1'
ID 588660
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
MMRRC Submission 045680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7612 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130135685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000030562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect possibly damaging
Transcript: ENSMUST00000030562
AA Change: V201A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119423
AA Change: V201A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120154
AA Change: V201A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164887
AA Change: V201A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R3028:Hcrtr1 UTSW 4 130135811 missense probably benign 0.31
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R5636:Hcrtr1 UTSW 4 130130945 missense possibly damaging 0.59
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7042:Hcrtr1 UTSW 4 130130860 unclassified probably benign
R7091:Hcrtr1 UTSW 4 130130914 missense probably damaging 0.99
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
R9410:Hcrtr1 UTSW 4 130135721 missense probably damaging 0.98
R9485:Hcrtr1 UTSW 4 130137261 missense possibly damaging 0.95
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAGAGCCTAGAATTGCCC -3'
(R):5'- TGGGCTGTGAACTGTTTCCC -3'

Sequencing Primer
(F):5'- AGCCTAGAATTGCCCAGTCTAGTG -3'
(R):5'- TCAGTGGCAGTGCTGACTCTC -3'
Posted On 2019-10-24