Incidental Mutation 'R7612:Vwa3a'
ID 588667
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Name von Willebrand factor A domain containing 3A
Synonyms E030013G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7612 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 120739318-120805742 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120752615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 34 (D34V)
Ref Sequence ENSEMBL: ENSMUSP00000129136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]
AlphaFold Q3UVV9
Predicted Effect probably null
Transcript: ENSMUST00000033180
AA Change: D34V

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: D34V

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166668
AA Change: D34V

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: D34V

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167213
AA Change: D34V

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: D34V

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168600
AA Change: D34V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: D34V

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
PIT4812001:Vwa3a UTSW 7 120776133 missense probably damaging 1.00
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R2408:Vwa3a UTSW 7 120773294 missense probably benign 0.00
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6279:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120762423 missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
R7135:Vwa3a UTSW 7 120773030 missense possibly damaging 0.69
R7215:Vwa3a UTSW 7 120795630 missense possibly damaging 0.83
R7282:Vwa3a UTSW 7 120786465 missense probably benign 0.03
R7351:Vwa3a UTSW 7 120776336 missense probably damaging 0.99
R7406:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R7557:Vwa3a UTSW 7 120795618 missense possibly damaging 0.90
R7699:Vwa3a UTSW 7 120752618 missense probably damaging 1.00
R7823:Vwa3a UTSW 7 120772962 missense probably damaging 1.00
R8074:Vwa3a UTSW 7 120799098 missense probably benign 0.00
R8730:Vwa3a UTSW 7 120782687 missense probably damaging 0.97
R8768:Vwa3a UTSW 7 120776076 missense probably damaging 1.00
R8941:Vwa3a UTSW 7 120776088 missense probably benign 0.00
R9116:Vwa3a UTSW 7 120767247 missense
R9134:Vwa3a UTSW 7 120778436 missense probably damaging 0.96
R9264:Vwa3a UTSW 7 120775464 missense probably benign
R9450:Vwa3a UTSW 7 120804030 critical splice donor site probably null
R9464:Vwa3a UTSW 7 120786459 missense possibly damaging 0.84
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Z1177:Vwa3a UTSW 7 120759133 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCATTAGGAACCCAAAGGG -3'
(R):5'- CTCCTCGTTCATTTCTAAATCTAGGGG -3'

Sequencing Primer
(F):5'- CCAAAGGGGACGGAGAGG -3'
(R):5'- TTTCTAAATCTAGGGGGCTACAGAG -3'
Posted On 2019-10-24