Incidental Mutation 'R7612:Cpne2'
ID588670
Institutional Source Beutler Lab
Gene Symbol Cpne2
Ensembl Gene ENSMUSG00000034361
Gene Namecopine II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7612 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94532990-94570531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94557420 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 290 (I290L)
Ref Sequence ENSEMBL: ENSMUSP00000045755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048653] [ENSMUST00000109537]
Predicted Effect probably benign
Transcript: ENSMUST00000048653
AA Change: I290L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000045755
Gene: ENSMUSG00000034361
AA Change: I290L

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 507 7.26e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109537
AA Change: I290L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105163
Gene: ENSMUSG00000034361
AA Change: I290L

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 506 8.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212550
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Cpne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cpne2 APN 8 94554753 missense possibly damaging 0.84
IGL02702:Cpne2 APN 8 94570023 missense probably benign 0.03
IGL03277:Cpne2 APN 8 94548372 missense probably benign 0.00
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0126:Cpne2 UTSW 8 94554933 missense probably damaging 1.00
R0135:Cpne2 UTSW 8 94554925 unclassified probably benign
R0167:Cpne2 UTSW 8 94568579 unclassified probably benign
R0661:Cpne2 UTSW 8 94556039 missense possibly damaging 0.78
R0671:Cpne2 UTSW 8 94548342 start gained probably benign
R4691:Cpne2 UTSW 8 94558221 missense probably damaging 0.99
R4856:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R4886:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R6632:Cpne2 UTSW 8 94554955 missense probably benign 0.00
R6699:Cpne2 UTSW 8 94563959 missense probably damaging 0.99
R6968:Cpne2 UTSW 8 94548502 missense probably damaging 1.00
R7117:Cpne2 UTSW 8 94555544 missense probably damaging 1.00
R7505:Cpne2 UTSW 8 94548466 missense possibly damaging 0.90
R7571:Cpne2 UTSW 8 94551780 missense probably benign
R7583:Cpne2 UTSW 8 94555581 missense probably benign
R7745:Cpne2 UTSW 8 94568684 missense probably damaging 1.00
R7845:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R7928:Cpne2 UTSW 8 94551204 missense probably benign 0.16
X0025:Cpne2 UTSW 8 94557451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTAATTGGCAGGTGTGACTG -3'
(R):5'- AGGCTAGTTCCATTCCTTGC -3'

Sequencing Primer
(F):5'- GCCTAGAATGGTCCTCATGC -3'
(R):5'- TTGCCCCAAGGAAATTTATCAC -3'
Posted On2019-10-24