Incidental Mutation 'R7612:Maml2'
ID 588672
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Name mastermind like transcriptional coactivator 2
Synonyms
MMRRC Submission 045680-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7612 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 13298306-13620684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13617781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 376 (M376V)
Ref Sequence ENSEMBL: ENSMUSP00000034401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294] [ENSMUST00000177755]
AlphaFold F6U238
Predicted Effect probably benign
Transcript: ENSMUST00000034401
AA Change: M376V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925
AA Change: M376V

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159294
AA Change: M1132V
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: M1132V

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177755
AA Change: M376V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136866
Gene: ENSMUSG00000031925
AA Change: M376V

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,570,496 (GRCm39) Y181* probably null Het
Adgrf2 T G 17: 43,025,271 (GRCm39) K71T possibly damaging Het
Brca2 T A 5: 150,464,076 (GRCm39) M1280K probably benign Het
Card14 T C 11: 119,224,405 (GRCm39) S541P possibly damaging Het
Cd19 G T 7: 126,013,496 (GRCm39) Q98K possibly damaging Het
Ceacam5 T A 7: 17,493,341 (GRCm39) I788N possibly damaging Het
Cpne2 A T 8: 95,284,048 (GRCm39) I290L probably benign Het
Cpsf1 C T 15: 76,481,209 (GRCm39) V1216I probably benign Het
Csad G A 15: 102,097,357 (GRCm39) probably benign Het
Depdc7 T A 2: 104,560,853 (GRCm39) Q47L probably benign Het
Dnajc6 T A 4: 101,455,123 (GRCm39) S105T probably benign Het
Dsg4 C A 18: 20,604,047 (GRCm39) P838Q probably damaging Het
Efcab3 T A 11: 104,999,647 (GRCm39) Y179N possibly damaging Het
Egfr A T 11: 16,809,025 (GRCm39) N73I possibly damaging Het
Eya2 T C 2: 165,529,657 (GRCm39) probably null Het
Fubp1 A G 3: 151,923,652 (GRCm39) Q123R possibly damaging Het
Galns A G 8: 123,311,693 (GRCm39) I439T possibly damaging Het
Gm57858 A T 3: 36,079,506 (GRCm39) S261R possibly damaging Het
Gsdmd T G 15: 75,736,803 (GRCm39) L140R probably damaging Het
Hcrtr1 A G 4: 130,029,478 (GRCm39) V201A possibly damaging Het
Ildr2 T A 1: 166,135,361 (GRCm39) M371K probably benign Het
Kalrn G A 16: 34,134,582 (GRCm39) T412I possibly damaging Het
Kdm5b C T 1: 134,552,656 (GRCm39) Q1211* probably null Het
Loxhd1 T C 18: 77,517,671 (GRCm39) S1840P possibly damaging Het
Mgat4e T C 1: 134,469,745 (GRCm39) T100A probably damaging Het
Myo18b T A 5: 113,013,168 (GRCm39) T812S possibly damaging Het
Nanp T A 2: 150,881,158 (GRCm39) E30V probably null Het
Or2w1b G T 13: 21,300,217 (GRCm39) M118I probably damaging Het
Or4c107 T G 2: 88,788,849 (GRCm39) L13R probably damaging Het
Or5ac21 A T 16: 59,123,990 (GRCm39) H158L probably damaging Het
Parp3 T A 9: 106,351,393 (GRCm39) N241I probably benign Het
Piezo2 T C 18: 63,175,610 (GRCm39) N1924D probably benign Het
Pou1f1 A G 16: 65,326,811 (GRCm39) N137S probably damaging Het
Ptgdr A G 14: 45,096,094 (GRCm39) M206T probably damaging Het
Ptprd T C 4: 76,004,696 (GRCm39) T20A probably benign Het
Rexo1 G C 10: 80,385,497 (GRCm39) S520R probably benign Het
Sgip1 T A 4: 102,727,005 (GRCm39) S94T probably benign Het
Slc35e3 A G 10: 117,576,785 (GRCm39) V182A probably benign Het
Slfn2 A G 11: 82,961,089 (GRCm39) E356G probably damaging Het
Spry4 C A 18: 38,722,982 (GRCm39) K260N probably damaging Het
Sync A T 4: 129,187,375 (GRCm39) M136L probably benign Het
Tm7sf2 A G 19: 6,120,638 (GRCm39) V425A probably benign Het
Trim21 T A 7: 102,208,742 (GRCm39) M326L probably benign Het
Trim62 A G 4: 128,790,677 (GRCm39) Q158R probably benign Het
Tubgcp2 T A 7: 139,580,964 (GRCm39) K663M probably damaging Het
Uggt1 T C 1: 36,202,316 (GRCm39) I1094V probably damaging Het
Urb1 A G 16: 90,594,798 (GRCm39) S245P probably damaging Het
Vwa3a A T 7: 120,351,838 (GRCm39) D34V probably null Het
Zbtb45 C T 7: 12,741,326 (GRCm39) A311T possibly damaging Het
Zfp655 T C 5: 145,173,999 (GRCm39) S135P unknown Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13,532,900 (GRCm39) unclassified probably benign
IGL00424:Maml2 APN 9 13,532,208 (GRCm39) missense probably damaging 0.99
IGL02711:Maml2 APN 9 13,531,359 (GRCm39) missense probably benign 0.14
IGL03079:Maml2 APN 9 13,532,912 (GRCm39) unclassified probably benign
IGL03217:Maml2 APN 9 13,531,295 (GRCm39) missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13,532,755 (GRCm39) small deletion probably benign
FR4449:Maml2 UTSW 9 13,532,752 (GRCm39) small deletion probably benign
PIT4810001:Maml2 UTSW 9 13,531,320 (GRCm39) missense
R0102:Maml2 UTSW 9 13,617,228 (GRCm39) synonymous silent
R0318:Maml2 UTSW 9 13,531,890 (GRCm39) missense probably damaging 0.99
R0380:Maml2 UTSW 9 13,532,396 (GRCm39) nonsense probably null
R1433:Maml2 UTSW 9 13,617,797 (GRCm39) missense probably damaging 1.00
R1449:Maml2 UTSW 9 13,531,980 (GRCm39) missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13,608,641 (GRCm39) missense probably damaging 1.00
R2173:Maml2 UTSW 9 13,532,912 (GRCm39) unclassified probably benign
R2363:Maml2 UTSW 9 13,532,541 (GRCm39) missense probably damaging 1.00
R2426:Maml2 UTSW 9 13,617,794 (GRCm39) missense probably damaging 1.00
R2880:Maml2 UTSW 9 13,531,893 (GRCm39) splice site probably null
R3981:Maml2 UTSW 9 13,532,364 (GRCm39) missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13,531,449 (GRCm39) missense probably benign 0.22
R4117:Maml2 UTSW 9 13,617,230 (GRCm39) missense probably damaging 1.00
R4282:Maml2 UTSW 9 13,531,406 (GRCm39) missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13,531,371 (GRCm39) missense probably damaging 1.00
R4921:Maml2 UTSW 9 13,532,471 (GRCm39) missense probably damaging 1.00
R4957:Maml2 UTSW 9 13,531,572 (GRCm39) missense probably damaging 1.00
R5195:Maml2 UTSW 9 13,532,410 (GRCm39) missense probably damaging 0.98
R5428:Maml2 UTSW 9 13,617,191 (GRCm39) missense probably benign 0.30
R5448:Maml2 UTSW 9 13,617,763 (GRCm39) missense probably damaging 0.98
R5450:Maml2 UTSW 9 13,617,763 (GRCm39) missense probably damaging 0.98
R5455:Maml2 UTSW 9 13,617,039 (GRCm39) nonsense probably null
R5620:Maml2 UTSW 9 13,608,616 (GRCm39) missense probably damaging 1.00
R5973:Maml2 UTSW 9 13,532,915 (GRCm39) unclassified probably benign
R6009:Maml2 UTSW 9 13,532,294 (GRCm39) missense probably benign 0.02
R6054:Maml2 UTSW 9 13,532,695 (GRCm39) small deletion probably benign
R6257:Maml2 UTSW 9 13,531,722 (GRCm39) missense probably damaging 1.00
R6727:Maml2 UTSW 9 13,532,847 (GRCm39) unclassified probably benign
R6824:Maml2 UTSW 9 13,608,513 (GRCm39) missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13,617,131 (GRCm39) missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13,532,481 (GRCm39) unclassified probably benign
R7047:Maml2 UTSW 9 13,532,177 (GRCm39) unclassified probably benign
R7233:Maml2 UTSW 9 13,532,067 (GRCm39) missense
R7326:Maml2 UTSW 9 13,532,903 (GRCm39) missense
R7652:Maml2 UTSW 9 13,532,945 (GRCm39) missense
R7699:Maml2 UTSW 9 13,532,385 (GRCm39) missense
R7700:Maml2 UTSW 9 13,532,385 (GRCm39) missense
R7803:Maml2 UTSW 9 13,532,572 (GRCm39) small insertion probably benign
R7803:Maml2 UTSW 9 13,532,571 (GRCm39) small insertion probably benign
R7803:Maml2 UTSW 9 13,532,550 (GRCm39) small insertion probably benign
R8425:Maml2 UTSW 9 13,531,413 (GRCm39) missense
R8810:Maml2 UTSW 9 13,532,918 (GRCm39) missense
R9277:Maml2 UTSW 9 13,531,872 (GRCm39) missense
R9359:Maml2 UTSW 9 13,532,969 (GRCm39) nonsense probably null
R9403:Maml2 UTSW 9 13,532,969 (GRCm39) nonsense probably null
RF015:Maml2 UTSW 9 13,532,752 (GRCm39) small deletion probably benign
RF044:Maml2 UTSW 9 13,532,752 (GRCm39) small deletion probably benign
X0063:Maml2 UTSW 9 13,531,637 (GRCm39) missense probably benign 0.09
Z1177:Maml2 UTSW 9 13,617,886 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTCTAATATGAACCCATCAG -3'
(R):5'- CGCCAACCTTCTGTTTTGAGG -3'

Sequencing Primer
(F):5'- TCAGGGACAGGATTGAATCATCCC -3'
(R):5'- CAGACTTCAGCAGTTTGGCATTACAG -3'
Posted On 2019-10-24