Incidental Mutation 'R7612:Egfr'
ID588676
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R7612 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16859025 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 73 (N73I)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020329
AA Change: N73I

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: N73I

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102884
AA Change: N73I

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: N73I

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Meta Mutation Damage Score 0.8449 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
R8315:Egfr UTSW 11 16875027 missense probably benign 0.08
R8320:Egfr UTSW 11 16891251 missense probably damaging 1.00
R8324:Egfr UTSW 11 16858971 missense probably damaging 0.99
R8324:Egfr UTSW 11 16908885 missense probably damaging 0.98
R8347:Egfr UTSW 11 16878174 missense probably damaging 1.00
R8511:Egfr UTSW 11 16896949 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGGCTCCCAAAGTTG -3'
(R):5'- TCCCCTCAGATGAAGTTGCATATC -3'

Sequencing Primer
(F):5'- GGCTCCCAAAGTTGATGATTATTG -3'
(R):5'- ACTTTGTAGACCAAGCTGGC -3'
Posted On2019-10-24