Incidental Mutation 'R7612:Dsg4'
ID588691
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R7612 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20470990 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 838 (P838Q)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: P838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: P838Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATCTTAGAAAGCGTATGC -3'
(R):5'- TTGGACACATGGGTCAGAAG -3'

Sequencing Primer
(F):5'- CCCATCTTAGAAAGCGTATGCATATG -3'
(R):5'- TCAGAAGTAGTGTAGGTCTCAGTCAC -3'
Posted On2019-10-24