Incidental Mutation 'R7613:Gucy1b1'
ID588704
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Nameguanylate cyclase 1, soluble, beta 1
Synonymsbeta 1 sGC
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R7613 (G1)
Quality Score214.009
Status Not validated
Chromosome3
Chromosomal Location82032006-82074689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82039747 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 385 (D385V)
Ref Sequence ENSEMBL: ENSMUSP00000029635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029635
AA Change: D385V

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: D385V

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193597
AA Change: D385V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: D385V

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 82034862 missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 82034868 missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 82035285 missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 82046526 missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 82058329 missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 82039861 missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 82034878 missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 82034391 missense probably benign
R0126:Gucy1b1 UTSW 3 82037911 splice site probably benign
R0277:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 82045460 missense probably benign 0.02
R0691:Gucy1b1 UTSW 3 82045634 splice site probably benign
R0811:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 82045460 missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 82038042 missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 82058352 missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 82045409 missense probably benign 0.43
R1995:Gucy1b1 UTSW 3 82034853 missense probably damaging 1.00
R2156:Gucy1b1 UTSW 3 82061020 missense probably benign
R2441:Gucy1b1 UTSW 3 82045454 missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 82046667 missense probably benign 0.43
R5397:Gucy1b1 UTSW 3 82044151 missense possibly damaging 0.92
R5494:Gucy1b1 UTSW 3 82039876 missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 82058277 missense probably damaging 1.00
R6088:Gucy1b1 UTSW 3 82034880 missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 82046713 splice site probably null
R6331:Gucy1b1 UTSW 3 82034411 missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 82034408 missense probably benign
R6753:Gucy1b1 UTSW 3 82039747 missense probably null 0.03
R7150:Gucy1b1 UTSW 3 82043162 missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 82033274 missense unknown
R7461:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 82035359 missense probably damaging 1.00
R7791:Gucy1b1 UTSW 3 82035397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTAGAAGATAAGGGTTCCACTGC -3'
(R):5'- TGAACCTGGACGACCTAACAAG -3'

Sequencing Primer
(F):5'- CACTGCAGATTTGTGGAACC -3'
(R):5'- CCTAACAAGAAGAGGCCTGTATCTG -3'
Posted On2019-10-24