Mutagenetix > Incidental Mutation

Incidental Mutation 'R7613:Gucy1b1'

588704

Institutional Source

Beutler Lab

Gene Symbol

Gucy1b1

Ensembl Gene

ENSMUSG00000028005

Gene Name

guanylate cyclase 1, soluble, beta 1

Synonyms

beta 1 sGC

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.799) question?

Stock #

R7613 (G1)

Quality Score

214.009

Status

Validated

Chromosome

Chromosomal Location

82032006-82074689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82039747 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 385 (D385V)

Ref Sequence

ENSEMBL: ENSMUSP00000029635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]

AlphaFold

O54865

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029635
AA Change: D385V

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: D385V

Domain	Start	End	E-Value	Type
Pfam:HNOB	2	166	3.4e-58	PFAM
low complexity region	182	189	N/A	INTRINSIC
PDB:4GJ4\|D	212	343	9e-16	PDB
CYCc	385	586	3.53e-93	SMART
low complexity region	608	620	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193597
AA Change: D385V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: D385V

Domain	Start	End	E-Value	Type
Pfam:HNOB	1	172	1.5e-67	PFAM
low complexity region	182	189	N/A	INTRINSIC
PDB:4GJ4\|D	212	343	9e-16	PDB
CYCc	385	582	1.71e-91	SMART

Meta Mutation Damage Score

0.0642

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adgrb2	CTATA	CTATATA	4: 130,021,213		probably benign	Het
Adh1	T	A	3: 138,286,831	L236*	probably null	Het
Akt2	A	G	7: 27,637,170	I448V	probably benign	Het
Anapc5	G	A	5: 122,818,865	T117M	probably damaging	Het
Cacna1d	A	T	14: 30,066,163	D1605E	probably benign	Het
Celsr2	C	T	3: 108,395,640	G2506R	probably damaging	Het
Cenpe	T	A	3: 135,242,302	F31L	possibly damaging	Het
Cenpj	G	A	14: 56,527,044	R1304*	probably null	Het
Cfap58	A	G	19: 47,982,122	D593G	possibly damaging	Het
Crip2	T	C	12: 113,144,157		probably null	Het
Crocc2	G	T	1: 93,194,589	A735S	possibly damaging	Het
Dnah2	A	G	11: 69,548,990		probably null	Het
Dpp8	C	T	9: 65,053,120	T311M	possibly damaging	Het
Eps15	T	C	4: 109,329,725	S330P	probably damaging	Het
Exoc2	C	T	13: 30,882,272	V474I	probably benign	Het
Foxn2	T	C	17: 88,486,883	I416T	possibly damaging	Het
Gbp8	T	C	5: 105,031,014	E145G	probably damaging	Het
Gm3676	T	A	14: 41,643,276	I141L	probably benign	Het
Gm4131	A	G	14: 62,481,089	Y23H	possibly damaging	Het
Gm884	G	T	11: 103,616,290	H1617Q	unknown	Het
Hdac2	T	C	10: 36,989,236	S149P	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igsf9b	A	T	9: 27,334,122	R1128S	probably benign	Het
Invs	A	G	4: 48,392,668	H294R	probably damaging	Het
Kansl3	G	A	1: 36,343,795	S812F	probably damaging	Het
Katnbl1	T	C	2: 112,409,193	S246P	probably benign	Het
Kcnt1	A	T	2: 25,901,346	H567L	probably benign	Het
Krt33a	A	G	11: 100,011,939	I353T	probably damaging	Het
Lrguk	A	T	6: 34,101,748	R639S	possibly damaging	Het
Mcoln2	A	T	3: 146,175,544		probably null	Het
Myo15	A	G	11: 60,505,152	T1438A		Het
Myocd	A	G	11: 65,218,603	L114P	probably damaging	Het
Nutm1	T	C	2: 112,249,239	N777S	probably benign	Het
Olfr1444	A	T	19: 12,861,777	M1L	probably benign	Het
Pde4b	A	G	4: 102,255,306	E29G	probably damaging	Het
Plekhn1	G	A	4: 156,224,820	P210S	probably benign	Het
Por	G	T	5: 135,729,504	A112S	probably damaging	Het
Prkcq	T	C	2: 11,299,410	F651S	probably damaging	Het
Rnf148	A	C	6: 23,654,980	S6A	probably benign	Het
Selenoi	A	G	5: 30,266,928	I376V	possibly damaging	Het
Skint6	A	T	4: 113,177,046		probably null	Het
Tdrd6	T	C	17: 43,627,926	T744A	probably benign	Het
Tet2	T	A	3: 133,466,748	T1918S	possibly damaging	Het
Ttc28	C	A	5: 111,224,129	L846M	probably damaging	Het
Ubxn2a	A	T	12: 4,883,832	V193D	possibly damaging	Het
Umodl1	T	A	17: 30,988,057	C807*	probably null	Het
Upf2	T	A	2: 5,973,536	S404T	unknown	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp53	A	T	3: 122,949,818	S490T	probably benign	Het
Wscd1	T	C	11: 71,759,973	L42P	possibly damaging	Het
Xirp2	T	C	2: 67,514,498	I2361T	probably benign	Het

Other mutations in Gucy1b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Gucy1b1	APN	3	82034862	missense	probably damaging	1.00
IGL01602:Gucy1b1	APN	3	82035353	missense	probably benign	0.17
IGL01603:Gucy1b1	APN	3	82034868	missense	probably damaging	0.98
IGL01605:Gucy1b1	APN	3	82035353	missense	probably benign	0.17
IGL01685:Gucy1b1	APN	3	82035285	missense	probably benign	0.27
IGL01844:Gucy1b1	APN	3	82046526	missense	possibly damaging	0.95
IGL02566:Gucy1b1	APN	3	82058329	missense	probably damaging	1.00
R0014:Gucy1b1	UTSW	3	82039861	missense	probably damaging	1.00
R0068:Gucy1b1	UTSW	3	82034878	missense	probably benign	0.34
R0115:Gucy1b1	UTSW	3	82034391	missense	probably benign
R0126:Gucy1b1	UTSW	3	82037911	splice site	probably benign
R0277:Gucy1b1	UTSW	3	82038156	critical splice acceptor site	probably null
R0323:Gucy1b1	UTSW	3	82038156	critical splice acceptor site	probably null
R0633:Gucy1b1	UTSW	3	82045460	missense	probably benign	0.02
R0691:Gucy1b1	UTSW	3	82045634	splice site	probably benign
R0811:Gucy1b1	UTSW	3	82037988	missense	probably benign	0.04
R0812:Gucy1b1	UTSW	3	82037988	missense	probably benign	0.04
R1670:Gucy1b1	UTSW	3	82045460	missense	probably benign	0.10
R1687:Gucy1b1	UTSW	3	82038042	missense	probably damaging	1.00
R1856:Gucy1b1	UTSW	3	82058352	missense	probably benign	0.00
R1950:Gucy1b1	UTSW	3	82045409	missense	probably benign	0.43
R1995:Gucy1b1	UTSW	3	82034853	missense	probably damaging	1.00
R2156:Gucy1b1	UTSW	3	82061020	missense	probably benign
R2441:Gucy1b1	UTSW	3	82045454	missense	probably damaging	0.98
R5014:Gucy1b1	UTSW	3	82046667	missense	probably benign	0.43
R5397:Gucy1b1	UTSW	3	82044151	missense	possibly damaging	0.92
R5494:Gucy1b1	UTSW	3	82039876	missense	probably damaging	1.00
R6003:Gucy1b1	UTSW	3	82058277	missense	probably damaging	1.00
R6088:Gucy1b1	UTSW	3	82034880	missense	probably damaging	1.00
R6216:Gucy1b1	UTSW	3	82046713	splice site	probably null
R6331:Gucy1b1	UTSW	3	82034411	missense	possibly damaging	0.75
R6671:Gucy1b1	UTSW	3	82034408	missense	probably benign
R6753:Gucy1b1	UTSW	3	82039747	missense	probably null	0.03
R7150:Gucy1b1	UTSW	3	82043162	missense	probably damaging	1.00
R7228:Gucy1b1	UTSW	3	82033274	missense	unknown
R7461:Gucy1b1	UTSW	3	82039747	missense	possibly damaging	0.74
R7501:Gucy1b1	UTSW	3	82035359	missense	probably damaging	1.00
R7791:Gucy1b1	UTSW	3	82035397	nonsense	probably null
R8560:Gucy1b1	UTSW	3	82035378	missense	probably damaging	0.98
R9312:Gucy1b1	UTSW	3	82034816	missense	probably damaging	1.00
R9553:Gucy1b1	UTSW	3	82039780	missense	probably damaging	1.00
R9559:Gucy1b1	UTSW	3	82039747	missense	possibly damaging	0.74
R9762:Gucy1b1	UTSW	3	82034758	missense	possibly damaging	0.76
Z1177:Gucy1b1	UTSW	3	82061112	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTAGAAGATAAGGGTTCCACTGC -3'
(R):5'- TGAACCTGGACGACCTAACAAG -3'

Sequencing Primer
(F):5'- CACTGCAGATTTGTGGAACC -3'
(R):5'- CCTAACAAGAAGAGGCCTGTATCTG -3'

Posted On

2019-10-24