Incidental Mutation 'R7613:Anapc5'
ID588720
Institutional Source Beutler Lab
Gene Symbol Anapc5
Ensembl Gene ENSMUSG00000029472
Gene Nameanaphase-promoting complex subunit 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122787459-122821339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122818865 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 117 (T117M)
Ref Sequence ENSEMBL: ENSMUSP00000083393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086216] [ENSMUST00000196423] [ENSMUST00000196640] [ENSMUST00000197074] [ENSMUST00000197719] [ENSMUST00000199406] [ENSMUST00000199926] [ENSMUST00000200645]
Predicted Effect probably damaging
Transcript: ENSMUST00000086216
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083393
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:ANAPC5 239 339 3.5e-34 PFAM
Pfam:ANAPC5 383 478 3.1e-3 PFAM
Blast:TPR 526 559 8e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196423
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143169
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 1.9e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196640
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142429
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.8e-31 PFAM
Pfam:Apc5 383 478 5.1e0 PFAM
Blast:TPR 526 559 7e-12 BLAST
Blast:TPR 566 599 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000197074
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143053
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 375 470 4.1e-3 PFAM
Blast:TPR 518 551 7e-12 BLAST
Blast:TPR 558 591 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000197719
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142579
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.7e-31 PFAM
Pfam:Apc5 370 465 5e0 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000199406
AA Change: T117M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142341
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 4.1e-31 PFAM
Pfam:TPR_10 287 322 2.7e-1 PFAM
Pfam:Apc5 383 478 4.4e0 PFAM
Pfam:TPR_10 533 577 2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199926
SMART Domains Protein: ENSMUSP00000142981
Gene: ENSMUSG00000029472

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200645
AA Change: T117M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142922
Gene: ENSMUSG00000029472
AA Change: T117M

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
Pfam:Apc5 239 339 3.9e-34 PFAM
Pfam:Apc5 370 465 4.1e-3 PFAM
Blast:TPR 513 546 7e-12 BLAST
Blast:TPR 553 586 5e-9 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Anapc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Anapc5 APN 5 122800613 missense possibly damaging 0.95
IGL03158:Anapc5 APN 5 122817897 missense probably benign
R0137:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R0319:Anapc5 UTSW 5 122818856 missense probably damaging 0.99
R0326:Anapc5 UTSW 5 122814604 missense probably benign 0.40
R0399:Anapc5 UTSW 5 122791753 missense probably damaging 0.99
R0633:Anapc5 UTSW 5 122800632 missense probably damaging 1.00
R1173:Anapc5 UTSW 5 122788418 missense possibly damaging 0.49
R1723:Anapc5 UTSW 5 122799343 missense probably damaging 0.96
R2018:Anapc5 UTSW 5 122800524 missense probably damaging 1.00
R2114:Anapc5 UTSW 5 122787938 missense probably benign 0.06
R4211:Anapc5 UTSW 5 122817905 missense probably benign
R4287:Anapc5 UTSW 5 122800601 missense probably benign 0.02
R4533:Anapc5 UTSW 5 122791735 missense possibly damaging 0.86
R4905:Anapc5 UTSW 5 122817910 missense probably benign 0.00
R5336:Anapc5 UTSW 5 122807337 missense probably damaging 1.00
R5499:Anapc5 UTSW 5 122788413 missense probably damaging 1.00
R5568:Anapc5 UTSW 5 122791925 utr 3 prime probably benign
R6481:Anapc5 UTSW 5 122800544 missense probably benign 0.27
R7461:Anapc5 UTSW 5 122818865 missense probably damaging 1.00
R7681:Anapc5 UTSW 5 122802139 missense probably benign 0.01
R7912:Anapc5 UTSW 5 122793435 critical splice donor site probably null
R8007:Anapc5 UTSW 5 122791900 missense probably benign
R8080:Anapc5 UTSW 5 122807338 missense probably damaging 1.00
R8488:Anapc5 UTSW 5 122817970 makesense probably null
R8517:Anapc5 UTSW 5 122821030 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCAGGAGAACAGAGCTG -3'
(R):5'- TCCCCTTTAAAGCAGACTTGTC -3'

Sequencing Primer
(F):5'- CCCACAGGTTACGGTCGAATAG -3'
(R):5'- GCAGACTTGTCTATAATTCAGGAC -3'
Posted On2019-10-24