Incidental Mutation 'R7613:Rnf148'
ID588722
Institutional Source Beutler Lab
Gene Symbol Rnf148
Ensembl Gene ENSMUSG00000078179
Gene Namering finger protein 148
SynonymsGreul3, 4933432M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location23653898-23655136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23654980 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 6 (S6A)
Ref Sequence ENSEMBL: ENSMUSP00000100592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000063548] [ENSMUST00000069074] [ENSMUST00000104979] [ENSMUST00000115354] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
Predicted Effect probably benign
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063548
SMART Domains Protein: ENSMUSP00000066906
Gene: ENSMUSG00000051956

DomainStartEndE-ValueType
Pfam:PA 94 162 3.6e-11 PFAM
RING 213 253 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104979
AA Change: S6A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000100592
Gene: ENSMUSG00000078179
AA Change: S6A

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
Pfam:PA 82 178 1e-13 PFAM
RING 269 309 1.82e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115354
SMART Domains Protein: ENSMUSP00000111011
Gene: ENSMUSG00000051956

DomainStartEndE-ValueType
Pfam:PA 70 165 1.9e-13 PFAM
RING 256 296 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Rnf148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf148 APN 6 23655002 intron probably benign
IGL02307:Rnf148 APN 6 23654891 missense probably benign 0.34
IGL02347:Rnf148 APN 6 23654730 missense probably benign 0.01
IGL02366:Rnf148 APN 6 23654059 missense probably benign 0.12
IGL02598:Rnf148 APN 6 23654457 missense probably damaging 1.00
R0427:Rnf148 UTSW 6 23654073 missense probably damaging 0.99
R0458:Rnf148 UTSW 6 23654257 missense probably benign 0.37
R0465:Rnf148 UTSW 6 23654685 missense probably benign 0.02
R0514:Rnf148 UTSW 6 23654793 missense possibly damaging 0.95
R0538:Rnf148 UTSW 6 23654238 missense probably damaging 1.00
R0658:Rnf148 UTSW 6 23654457 missense probably damaging 1.00
R1831:Rnf148 UTSW 6 23654773 missense probably damaging 1.00
R2238:Rnf148 UTSW 6 23654346 missense probably benign 0.41
R3741:Rnf148 UTSW 6 23654065 missense possibly damaging 0.78
R4933:Rnf148 UTSW 6 23654340 missense probably benign 0.02
R5188:Rnf148 UTSW 6 23654140 missense probably damaging 1.00
R6386:Rnf148 UTSW 6 23654484 missense probably damaging 1.00
R7231:Rnf148 UTSW 6 23654891 missense probably benign 0.34
R7526:Rnf148 UTSW 6 23654284 nonsense probably null
R8025:Rnf148 UTSW 6 23654197 missense possibly damaging 0.55
R8463:Rnf148 UTSW 6 23654802 missense probably benign 0.01
R8520:Rnf148 UTSW 6 23654170 missense probably damaging 1.00
R8545:Rnf148 UTSW 6 23654571 missense probably damaging 1.00
R8791:Rnf148 UTSW 6 23654994 start codon destroyed probably null 0.02
R8825:Rnf148 UTSW 6 23654379 missense probably benign 0.25
R8826:Rnf148 UTSW 6 23654379 missense probably benign 0.25
R8868:Rnf148 UTSW 6 23654541 missense probably damaging 0.98
R8931:Rnf148 UTSW 6 23654705 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGATCCGGTTTCCCACCTG -3'
(R):5'- CTCTGATGTCACAATTTACCCATTAGG -3'

Sequencing Primer
(F):5'- CCCACCTGGAATGTAATATTCAGATG -3'
(R):5'- GTCACAATTTACCCATTAGGAAGTC -3'
Posted On2019-10-24