Incidental Mutation 'R7613:Lrguk'
ID588723
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Nameleucine-rich repeats and guanylate kinase domain containing
Synonyms4921528H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34029448-34134034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34101748 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 639 (R639S)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: R639S

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAGTTGCAGCTACTTAGTCTCC -3'
(R):5'- GTGCTGAAGAACTGACCTGC -3'

Sequencing Primer
(F):5'- AGCTACTTAGTCTCCCCCAAGG -3'
(R):5'- CTGAAGAACTGACCTGCTGAGG -3'
Posted On2019-10-24