Incidental Mutation 'R7613:Lrguk'
ID 588723
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 045681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7613 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34078683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 639 (R639S)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: R639S

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 129,915,006 (GRCm39) probably benign Het
Adh1 T A 3: 137,992,592 (GRCm39) L236* probably null Het
Akt2 A G 7: 27,336,595 (GRCm39) I448V probably benign Het
Anapc5 G A 5: 122,956,928 (GRCm39) T117M probably damaging Het
Cacna1d A T 14: 29,788,120 (GRCm39) D1605E probably benign Het
Celsr2 C T 3: 108,302,956 (GRCm39) G2506R probably damaging Het
Cenpe T A 3: 134,948,063 (GRCm39) F31L possibly damaging Het
Cenpj G A 14: 56,764,501 (GRCm39) R1304* probably null Het
Cfap58 A G 19: 47,970,561 (GRCm39) D593G possibly damaging Het
Crip2 T C 12: 113,107,777 (GRCm39) probably null Het
Crocc2 G T 1: 93,122,311 (GRCm39) A735S possibly damaging Het
Dnah2 A G 11: 69,439,816 (GRCm39) probably null Het
Dpp8 C T 9: 64,960,402 (GRCm39) T311M possibly damaging Het
Eps15 T C 4: 109,186,922 (GRCm39) S330P probably damaging Het
Exoc2 C T 13: 31,066,255 (GRCm39) V474I probably benign Het
Foxn2 T C 17: 88,794,311 (GRCm39) I416T possibly damaging Het
Gbp8 T C 5: 105,178,880 (GRCm39) E145G probably damaging Het
Gm3676 T A 14: 41,365,233 (GRCm39) I141L probably benign Het
Gm4131 A G 14: 62,718,538 (GRCm39) Y23H possibly damaging Het
Gucy1b1 T A 3: 81,947,054 (GRCm39) D385V possibly damaging Het
Hdac2 T C 10: 36,865,232 (GRCm39) S149P probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igsf9b A T 9: 27,245,418 (GRCm39) R1128S probably benign Het
Invs A G 4: 48,392,668 (GRCm39) H294R probably damaging Het
Kansl3 G A 1: 36,382,876 (GRCm39) S812F probably damaging Het
Katnbl1 T C 2: 112,239,538 (GRCm39) S246P probably benign Het
Kcnt1 A T 2: 25,791,358 (GRCm39) H567L probably benign Het
Krt33a A G 11: 99,902,765 (GRCm39) I353T probably damaging Het
Lrrc37 G T 11: 103,507,116 (GRCm39) H1617Q unknown Het
Mcoln2 A T 3: 145,881,299 (GRCm39) probably null Het
Myo15a A G 11: 60,395,978 (GRCm39) T1438A Het
Myocd A G 11: 65,109,429 (GRCm39) L114P probably damaging Het
Nutm1 T C 2: 112,079,584 (GRCm39) N777S probably benign Het
Or5b21 A T 19: 12,839,141 (GRCm39) M1L probably benign Het
Pde4b A G 4: 102,112,503 (GRCm39) E29G probably damaging Het
Plekhn1 G A 4: 156,309,277 (GRCm39) P210S probably benign Het
Por G T 5: 135,758,358 (GRCm39) A112S probably damaging Het
Prkcq T C 2: 11,304,221 (GRCm39) F651S probably damaging Het
Rnf148 A C 6: 23,654,979 (GRCm39) S6A probably benign Het
Selenoi A G 5: 30,471,926 (GRCm39) I376V possibly damaging Het
Skint6 A T 4: 113,034,243 (GRCm39) probably null Het
Tdrd6 T C 17: 43,938,817 (GRCm39) T744A probably benign Het
Tet2 T A 3: 133,172,509 (GRCm39) T1918S possibly damaging Het
Ttc28 C A 5: 111,371,995 (GRCm39) L846M probably damaging Het
Ubxn2a A T 12: 4,933,832 (GRCm39) V193D possibly damaging Het
Umodl1 T A 17: 31,207,031 (GRCm39) C807* probably null Het
Upf2 T A 2: 5,978,347 (GRCm39) S404T unknown Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Usp53 A T 3: 122,743,467 (GRCm39) S490T probably benign Het
Wscd1 T C 11: 71,650,799 (GRCm39) L42P possibly damaging Het
Xirp2 T C 2: 67,344,842 (GRCm39) I2361T probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAGTTGCAGCTACTTAGTCTCC -3'
(R):5'- GTGCTGAAGAACTGACCTGC -3'

Sequencing Primer
(F):5'- AGCTACTTAGTCTCCCCCAAGG -3'
(R):5'- CTGAAGAACTGACCTGCTGAGG -3'
Posted On 2019-10-24