Incidental Mutation 'R7613:Hdac2'
ID588727
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36989236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 149 (S149P)
Ref Sequence ENSEMBL: ENSMUSP00000019911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect probably damaging
Transcript: ENSMUST00000019911
AA Change: S149P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: S149P

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105510
AA Change: S149P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: S149P

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0455:Hdac2 UTSW 10 36991836 missense probably damaging 1.00
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1101:Hdac2 UTSW 10 36991809 missense probably damaging 1.00
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6109:Hdac2 UTSW 10 36986389 missense probably null 0.83
R6447:Hdac2 UTSW 10 36993816 missense possibly damaging 0.95
R6519:Hdac2 UTSW 10 36989256 missense probably damaging 1.00
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
R8117:Hdac2 UTSW 10 36997970 missense probably damaging 1.00
R8187:Hdac2 UTSW 10 36988136 missense probably damaging 1.00
R8360:Hdac2 UTSW 10 36998063 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGCTTTTGAATGCCAAACC -3'
(R):5'- TGCAGGGGCTCACAACAAAC -3'

Sequencing Primer
(F):5'- CATGGCATATTTAATAGGGCTTCGC -3'
(R):5'- CCCTGGAAGACTCAGCATTAATC -3'
Posted On2019-10-24