Incidental Mutation 'R7613:Wscd1'
ID588731
Institutional Source Beutler Lab
Gene Symbol Wscd1
Ensembl Gene ENSMUSG00000020811
Gene NameWSC domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location71749920-71789647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71759973 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 42 (L42P)
Ref Sequence ENSEMBL: ENSMUSP00000021168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021168] [ENSMUST00000108510] [ENSMUST00000108511] [ENSMUST00000150531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021168
AA Change: L42P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021168
Gene: ENSMUSG00000020811
AA Change: L42P

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108510
AA Change: L42P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104150
Gene: ENSMUSG00000020811
AA Change: L42P

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108511
AA Change: L42P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104151
Gene: ENSMUSG00000020811
AA Change: L42P

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
WSC 139 231 8.72e-40 SMART
WSC 242 337 2.09e-28 SMART
Pfam:Sulfotransfer_1 413 525 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150531
AA Change: L42P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123659
Gene: ENSMUSG00000020811
AA Change: L42P

DomainStartEndE-ValueType
transmembrane domain 15 35 N/A INTRINSIC
Meta Mutation Damage Score 0.1926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Wscd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Wscd1 APN 11 71788942 missense possibly damaging 0.89
IGL01982:Wscd1 APN 11 71766873 missense possibly damaging 0.94
IGL01991:Wscd1 APN 11 71787723 nonsense probably null
IGL02211:Wscd1 APN 11 71788975 missense probably damaging 1.00
R0011:Wscd1 UTSW 11 71788828 missense probably damaging 1.00
R0011:Wscd1 UTSW 11 71788828 missense probably damaging 1.00
R0359:Wscd1 UTSW 11 71766866 missense probably damaging 1.00
R0371:Wscd1 UTSW 11 71788723 missense probably damaging 1.00
R1340:Wscd1 UTSW 11 71768760 missense probably benign 0.01
R1429:Wscd1 UTSW 11 71760174 missense probably damaging 0.99
R1511:Wscd1 UTSW 11 71788675 missense probably damaging 1.00
R1823:Wscd1 UTSW 11 71760218 missense probably benign 0.05
R4772:Wscd1 UTSW 11 71771976 critical splice donor site probably null
R4885:Wscd1 UTSW 11 71760146 missense probably damaging 1.00
R5221:Wscd1 UTSW 11 71768675 missense possibly damaging 0.53
R5714:Wscd1 UTSW 11 71784435 critical splice donor site probably null
R6351:Wscd1 UTSW 11 71759883 missense probably damaging 1.00
R7181:Wscd1 UTSW 11 71759883 missense probably damaging 1.00
R7184:Wscd1 UTSW 11 71788717 missense probably damaging 1.00
R7461:Wscd1 UTSW 11 71759973 missense possibly damaging 0.95
R7754:Wscd1 UTSW 11 71784365 missense probably damaging 1.00
R7875:Wscd1 UTSW 11 71788734 missense probably damaging 1.00
R8804:Wscd1 UTSW 11 71784335 missense probably damaging 1.00
Z1177:Wscd1 UTSW 11 71788800 nonsense probably null
Z1177:Wscd1 UTSW 11 71788985 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGGATGCTGGGATGATGC -3'
(R):5'- AGCTACCTCTATTATGGTTGGCTG -3'

Sequencing Primer
(F):5'- ATGATGCCCTTGGAGGCC -3'
(R):5'- CTGCGGGTCACTGGTGAG -3'
Posted On2019-10-24