Incidental Mutation 'R7613:Crip2'
ID588735
Institutional Source Beutler Lab
Gene Symbol Crip2
Ensembl Gene ENSMUSG00000006356
Gene Namecysteine rich protein 2
SynonymsCrp, ESP1, Hlp, CRP4, 0610010I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113140236-113145506 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 113144157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084882] [ENSMUST00000196015] [ENSMUST00000199089] [ENSMUST00000200380]
Predicted Effect probably null
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196015
SMART Domains Protein: ENSMUSP00000143009
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199089
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display abnormal inflammatory pain responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Crip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Crip2 APN 12 113144125 missense probably benign 0.03
R0732:Crip2 UTSW 12 113140558 unclassified probably benign
R1111:Crip2 UTSW 12 113144074 nonsense probably null
R1186:Crip2 UTSW 12 113144959 splice site probably benign
R1445:Crip2 UTSW 12 113143504 missense probably damaging 1.00
R1473:Crip2 UTSW 12 113143500 missense probably damaging 0.99
R1541:Crip2 UTSW 12 113144966 missense possibly damaging 0.65
R2270:Crip2 UTSW 12 113144866 missense probably damaging 0.99
R4852:Crip2 UTSW 12 113140584 missense probably damaging 1.00
R6935:Crip2 UTSW 12 113140593 missense probably damaging 1.00
R7461:Crip2 UTSW 12 113144157 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTTGGGAGAAGCTCTGTG -3'
(R):5'- ATGTACGTCCCTTGAGTCAGC -3'

Sequencing Primer
(F):5'- GCCTCTAGCCATTAATCTCCTGG -3'
(R):5'- CGGGGTAGGGAGTCACTTAC -3'
Posted On2019-10-24