Mutagenetix > Incidental Mutation

Incidental Mutation 'R7613:Exoc2'

588736

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

045681-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30882272 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 474 (V474I)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: V474I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: V474I

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: V474I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: V474I

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adgrb2	CTATA	CTATATA	4: 130,021,213		probably benign	Het
Adh1	T	A	3: 138,286,831	L236*	probably null	Het
Akt2	A	G	7: 27,637,170	I448V	probably benign	Het
Anapc5	G	A	5: 122,818,865	T117M	probably damaging	Het
Cacna1d	A	T	14: 30,066,163	D1605E	probably benign	Het
Celsr2	C	T	3: 108,395,640	G2506R	probably damaging	Het
Cenpe	T	A	3: 135,242,302	F31L	possibly damaging	Het
Cenpj	G	A	14: 56,527,044	R1304*	probably null	Het
Cfap58	A	G	19: 47,982,122	D593G	possibly damaging	Het
Crip2	T	C	12: 113,144,157		probably null	Het
Crocc2	G	T	1: 93,194,589	A735S	possibly damaging	Het
Dnah2	A	G	11: 69,548,990		probably null	Het
Dpp8	C	T	9: 65,053,120	T311M	possibly damaging	Het
Eps15	T	C	4: 109,329,725	S330P	probably damaging	Het
Foxn2	T	C	17: 88,486,883	I416T	possibly damaging	Het
Gbp8	T	C	5: 105,031,014	E145G	probably damaging	Het
Gm3676	T	A	14: 41,643,276	I141L	probably benign	Het
Gm4131	A	G	14: 62,481,089	Y23H	possibly damaging	Het
Gm884	G	T	11: 103,616,290	H1617Q	unknown	Het
Gucy1b1	T	A	3: 82,039,747	D385V	possibly damaging	Het
Hdac2	T	C	10: 36,989,236	S149P	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igsf9b	A	T	9: 27,334,122	R1128S	probably benign	Het
Invs	A	G	4: 48,392,668	H294R	probably damaging	Het
Kansl3	G	A	1: 36,343,795	S812F	probably damaging	Het
Katnbl1	T	C	2: 112,409,193	S246P	probably benign	Het
Kcnt1	A	T	2: 25,901,346	H567L	probably benign	Het
Krt33a	A	G	11: 100,011,939	I353T	probably damaging	Het
Lrguk	A	T	6: 34,101,748	R639S	possibly damaging	Het
Mcoln2	A	T	3: 146,175,544		probably null	Het
Myo15	A	G	11: 60,505,152	T1438A		Het
Myocd	A	G	11: 65,218,603	L114P	probably damaging	Het
Nutm1	T	C	2: 112,249,239	N777S	probably benign	Het
Olfr1444	A	T	19: 12,861,777	M1L	probably benign	Het
Pde4b	A	G	4: 102,255,306	E29G	probably damaging	Het
Plekhn1	G	A	4: 156,224,820	P210S	probably benign	Het
Por	G	T	5: 135,729,504	A112S	probably damaging	Het
Prkcq	T	C	2: 11,299,410	F651S	probably damaging	Het
Rnf148	A	C	6: 23,654,980	S6A	probably benign	Het
Selenoi	A	G	5: 30,266,928	I376V	possibly damaging	Het
Skint6	A	T	4: 113,177,046		probably null	Het
Tdrd6	T	C	17: 43,627,926	T744A	probably benign	Het
Tet2	T	A	3: 133,466,748	T1918S	possibly damaging	Het
Ttc28	C	A	5: 111,224,129	L846M	probably damaging	Het
Ubxn2a	A	T	12: 4,883,832	V193D	possibly damaging	Het
Umodl1	T	A	17: 30,988,057	C807*	probably null	Het
Upf2	T	A	2: 5,973,536	S404T	unknown	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp53	A	T	3: 122,949,818	S490T	probably benign	Het
Wscd1	T	C	11: 71,759,973	L42P	possibly damaging	Het
Xirp2	T	C	2: 67,514,498	I2361T	probably benign	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CATCCACACAATTTTCCACTGG -3'
(R):5'- TGCTGAGAGAAGTGCCTCAC -3'

Sequencing Primer
(F):5'- CCACTGTGTACAAGAGAACTTTGCTC -3'
(R):5'- CTGAGAGAAGTGCCTCACCAAAAG -3'

Posted On

2019-10-24