Incidental Mutation 'R7613:Exoc2'
ID588736
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Nameexocyst complex component 2
Synonyms2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location30813919-30974093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30882272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 474 (V474I)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: V474I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: V474I

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: V474I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: V474I

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATCCACACAATTTTCCACTGG -3'
(R):5'- TGCTGAGAGAAGTGCCTCAC -3'

Sequencing Primer
(F):5'- CCACTGTGTACAAGAGAACTTTGCTC -3'
(R):5'- CTGAGAGAAGTGCCTCACCAAAAG -3'
Posted On2019-10-24