Mutagenetix > Incidental Mutation

Incidental Mutation 'R7613:Umodl1'

588742

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7613 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 30988057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 807 (C807*)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably null
Transcript: ENSMUST00000066554
AA Change: C807*

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: C807*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000066981

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114555
AA Change: C807*

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: C807*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.9641

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adgrb2	CTATA	CTATATA	4: 130,021,213		probably benign	Het
Adh1	T	A	3: 138,286,831	L236*	probably null	Het
Akt2	A	G	7: 27,637,170	I448V	probably benign	Het
Anapc5	G	A	5: 122,818,865	T117M	probably damaging	Het
Cacna1d	A	T	14: 30,066,163	D1605E	probably benign	Het
Celsr2	C	T	3: 108,395,640	G2506R	probably damaging	Het
Cenpe	T	A	3: 135,242,302	F31L	possibly damaging	Het
Cenpj	G	A	14: 56,527,044	R1304*	probably null	Het
Cfap58	A	G	19: 47,982,122	D593G	possibly damaging	Het
Crip2	T	C	12: 113,144,157		probably null	Het
Crocc2	G	T	1: 93,194,589	A735S	possibly damaging	Het
Dnah2	A	G	11: 69,548,990		probably null	Het
Dpp8	C	T	9: 65,053,120	T311M	possibly damaging	Het
Eps15	T	C	4: 109,329,725	S330P	probably damaging	Het
Exoc2	C	T	13: 30,882,272	V474I	probably benign	Het
Foxn2	T	C	17: 88,486,883	I416T	possibly damaging	Het
Gbp8	T	C	5: 105,031,014	E145G	probably damaging	Het
Gm3676	T	A	14: 41,643,276	I141L	probably benign	Het
Gm4131	A	G	14: 62,481,089	Y23H	possibly damaging	Het
Gm884	G	T	11: 103,616,290	H1617Q	unknown	Het
Gucy1b1	T	A	3: 82,039,747	D385V	possibly damaging	Het
Hdac2	T	C	10: 36,989,236	S149P	probably damaging	Het
Hivep3	CGG	CG	4: 120,097,911	1141	probably null	Het
Igsf9b	A	T	9: 27,334,122	R1128S	probably benign	Het
Invs	A	G	4: 48,392,668	H294R	probably damaging	Het
Kansl3	G	A	1: 36,343,795	S812F	probably damaging	Het
Katnbl1	T	C	2: 112,409,193	S246P	probably benign	Het
Kcnt1	A	T	2: 25,901,346	H567L	probably benign	Het
Krt33a	A	G	11: 100,011,939	I353T	probably damaging	Het
Lrguk	A	T	6: 34,101,748	R639S	possibly damaging	Het
Mcoln2	A	T	3: 146,175,544		probably null	Het
Myo15	A	G	11: 60,505,152	T1438A		Het
Myocd	A	G	11: 65,218,603	L114P	probably damaging	Het
Nutm1	T	C	2: 112,249,239	N777S	probably benign	Het
Olfr1444	A	T	19: 12,861,777	M1L	probably benign	Het
Pde4b	A	G	4: 102,255,306	E29G	probably damaging	Het
Plekhn1	G	A	4: 156,224,820	P210S	probably benign	Het
Por	G	T	5: 135,729,504	A112S	probably damaging	Het
Prkcq	T	C	2: 11,299,410	F651S	probably damaging	Het
Rnf148	A	C	6: 23,654,980	S6A	probably benign	Het
Selenoi	A	G	5: 30,266,928	I376V	possibly damaging	Het
Skint6	A	T	4: 113,177,046		probably null	Het
Tdrd6	T	C	17: 43,627,926	T744A	probably benign	Het
Tet2	T	A	3: 133,466,748	T1918S	possibly damaging	Het
Ttc28	C	A	5: 111,224,129	L846M	probably damaging	Het
Ubxn2a	A	T	12: 4,883,832	V193D	possibly damaging	Het
Upf2	T	A	2: 5,973,536	S404T	unknown	Het
Urb1	CACTTAC	CAC	16: 90,772,573		probably benign	Het
Usp53	A	T	3: 122,949,818	S490T	probably benign	Het
Wscd1	T	C	11: 71,759,973	L42P	possibly damaging	Het
Xirp2	T	C	2: 67,514,498	I2361T	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCAGTACCAGCTTCTCC -3'
(R):5'- ACTGTGGGAAGGACTGTCTC -3'

Sequencing Primer
(F):5'- AGCTTCTCCCTCGAGTGG -3'
(R):5'- GTGTTGTTATTCAAGTCTGACACC -3'

Posted On

2019-10-24