Incidental Mutation 'R7613:Umodl1'
ID 588742
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 045681-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7613 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 31207031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 807 (C807*)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably null
Transcript: ENSMUST00000066554
AA Change: C807*
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: C807*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
AA Change: C807*
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: C807*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9641 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 129,915,006 (GRCm39) probably benign Het
Adh1 T A 3: 137,992,592 (GRCm39) L236* probably null Het
Akt2 A G 7: 27,336,595 (GRCm39) I448V probably benign Het
Anapc5 G A 5: 122,956,928 (GRCm39) T117M probably damaging Het
Cacna1d A T 14: 29,788,120 (GRCm39) D1605E probably benign Het
Celsr2 C T 3: 108,302,956 (GRCm39) G2506R probably damaging Het
Cenpe T A 3: 134,948,063 (GRCm39) F31L possibly damaging Het
Cenpj G A 14: 56,764,501 (GRCm39) R1304* probably null Het
Cfap58 A G 19: 47,970,561 (GRCm39) D593G possibly damaging Het
Crip2 T C 12: 113,107,777 (GRCm39) probably null Het
Crocc2 G T 1: 93,122,311 (GRCm39) A735S possibly damaging Het
Dnah2 A G 11: 69,439,816 (GRCm39) probably null Het
Dpp8 C T 9: 64,960,402 (GRCm39) T311M possibly damaging Het
Eps15 T C 4: 109,186,922 (GRCm39) S330P probably damaging Het
Exoc2 C T 13: 31,066,255 (GRCm39) V474I probably benign Het
Foxn2 T C 17: 88,794,311 (GRCm39) I416T possibly damaging Het
Gbp8 T C 5: 105,178,880 (GRCm39) E145G probably damaging Het
Gm3676 T A 14: 41,365,233 (GRCm39) I141L probably benign Het
Gm4131 A G 14: 62,718,538 (GRCm39) Y23H possibly damaging Het
Gucy1b1 T A 3: 81,947,054 (GRCm39) D385V possibly damaging Het
Hdac2 T C 10: 36,865,232 (GRCm39) S149P probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igsf9b A T 9: 27,245,418 (GRCm39) R1128S probably benign Het
Invs A G 4: 48,392,668 (GRCm39) H294R probably damaging Het
Kansl3 G A 1: 36,382,876 (GRCm39) S812F probably damaging Het
Katnbl1 T C 2: 112,239,538 (GRCm39) S246P probably benign Het
Kcnt1 A T 2: 25,791,358 (GRCm39) H567L probably benign Het
Krt33a A G 11: 99,902,765 (GRCm39) I353T probably damaging Het
Lrguk A T 6: 34,078,683 (GRCm39) R639S possibly damaging Het
Lrrc37 G T 11: 103,507,116 (GRCm39) H1617Q unknown Het
Mcoln2 A T 3: 145,881,299 (GRCm39) probably null Het
Myo15a A G 11: 60,395,978 (GRCm39) T1438A Het
Myocd A G 11: 65,109,429 (GRCm39) L114P probably damaging Het
Nutm1 T C 2: 112,079,584 (GRCm39) N777S probably benign Het
Or5b21 A T 19: 12,839,141 (GRCm39) M1L probably benign Het
Pde4b A G 4: 102,112,503 (GRCm39) E29G probably damaging Het
Plekhn1 G A 4: 156,309,277 (GRCm39) P210S probably benign Het
Por G T 5: 135,758,358 (GRCm39) A112S probably damaging Het
Prkcq T C 2: 11,304,221 (GRCm39) F651S probably damaging Het
Rnf148 A C 6: 23,654,979 (GRCm39) S6A probably benign Het
Selenoi A G 5: 30,471,926 (GRCm39) I376V possibly damaging Het
Skint6 A T 4: 113,034,243 (GRCm39) probably null Het
Tdrd6 T C 17: 43,938,817 (GRCm39) T744A probably benign Het
Tet2 T A 3: 133,172,509 (GRCm39) T1918S possibly damaging Het
Ttc28 C A 5: 111,371,995 (GRCm39) L846M probably damaging Het
Ubxn2a A T 12: 4,933,832 (GRCm39) V193D possibly damaging Het
Upf2 T A 2: 5,978,347 (GRCm39) S404T unknown Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Usp53 A T 3: 122,743,467 (GRCm39) S490T probably benign Het
Wscd1 T C 11: 71,650,799 (GRCm39) L42P possibly damaging Het
Xirp2 T C 2: 67,344,842 (GRCm39) I2361T probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGTACCAGCTTCTCC -3'
(R):5'- ACTGTGGGAAGGACTGTCTC -3'

Sequencing Primer
(F):5'- AGCTTCTCCCTCGAGTGG -3'
(R):5'- GTGTTGTTATTCAAGTCTGACACC -3'
Posted On 2019-10-24