Incidental Mutation 'R7613:Umodl1'
ID588742
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30988057 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 807 (C807*)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably null
Transcript: ENSMUST00000066554
AA Change: C807*
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: C807*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
AA Change: C807*
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: C807*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9641 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGACCAGTACCAGCTTCTCC -3'
(R):5'- ACTGTGGGAAGGACTGTCTC -3'

Sequencing Primer
(F):5'- AGCTTCTCCCTCGAGTGG -3'
(R):5'- GTGTTGTTATTCAAGTCTGACACC -3'
Posted On2019-10-24