Incidental Mutation 'R7613:Acta2'
ID 588746
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Name actin alpha 2, smooth muscle, aorta
Synonyms Actvs, alphaSMA, SMalphaA, SMAalpha, 0610041G09Rik, a-SMA
MMRRC Submission 045681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R7613 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34218490-34232990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34229931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631]
AlphaFold P62737
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: T8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: T8I

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 CTATA CTATATA 4: 129,915,006 (GRCm39) probably benign Het
Adh1 T A 3: 137,992,592 (GRCm39) L236* probably null Het
Akt2 A G 7: 27,336,595 (GRCm39) I448V probably benign Het
Anapc5 G A 5: 122,956,928 (GRCm39) T117M probably damaging Het
Cacna1d A T 14: 29,788,120 (GRCm39) D1605E probably benign Het
Celsr2 C T 3: 108,302,956 (GRCm39) G2506R probably damaging Het
Cenpe T A 3: 134,948,063 (GRCm39) F31L possibly damaging Het
Cenpj G A 14: 56,764,501 (GRCm39) R1304* probably null Het
Cfap58 A G 19: 47,970,561 (GRCm39) D593G possibly damaging Het
Crip2 T C 12: 113,107,777 (GRCm39) probably null Het
Crocc2 G T 1: 93,122,311 (GRCm39) A735S possibly damaging Het
Dnah2 A G 11: 69,439,816 (GRCm39) probably null Het
Dpp8 C T 9: 64,960,402 (GRCm39) T311M possibly damaging Het
Eps15 T C 4: 109,186,922 (GRCm39) S330P probably damaging Het
Exoc2 C T 13: 31,066,255 (GRCm39) V474I probably benign Het
Foxn2 T C 17: 88,794,311 (GRCm39) I416T possibly damaging Het
Gbp8 T C 5: 105,178,880 (GRCm39) E145G probably damaging Het
Gm3676 T A 14: 41,365,233 (GRCm39) I141L probably benign Het
Gm4131 A G 14: 62,718,538 (GRCm39) Y23H possibly damaging Het
Gucy1b1 T A 3: 81,947,054 (GRCm39) D385V possibly damaging Het
Hdac2 T C 10: 36,865,232 (GRCm39) S149P probably damaging Het
Hivep3 CGG CG 4: 119,955,108 (GRCm39) 1141 probably null Het
Igsf9b A T 9: 27,245,418 (GRCm39) R1128S probably benign Het
Invs A G 4: 48,392,668 (GRCm39) H294R probably damaging Het
Kansl3 G A 1: 36,382,876 (GRCm39) S812F probably damaging Het
Katnbl1 T C 2: 112,239,538 (GRCm39) S246P probably benign Het
Kcnt1 A T 2: 25,791,358 (GRCm39) H567L probably benign Het
Krt33a A G 11: 99,902,765 (GRCm39) I353T probably damaging Het
Lrguk A T 6: 34,078,683 (GRCm39) R639S possibly damaging Het
Lrrc37 G T 11: 103,507,116 (GRCm39) H1617Q unknown Het
Mcoln2 A T 3: 145,881,299 (GRCm39) probably null Het
Myo15a A G 11: 60,395,978 (GRCm39) T1438A Het
Myocd A G 11: 65,109,429 (GRCm39) L114P probably damaging Het
Nutm1 T C 2: 112,079,584 (GRCm39) N777S probably benign Het
Or5b21 A T 19: 12,839,141 (GRCm39) M1L probably benign Het
Pde4b A G 4: 102,112,503 (GRCm39) E29G probably damaging Het
Plekhn1 G A 4: 156,309,277 (GRCm39) P210S probably benign Het
Por G T 5: 135,758,358 (GRCm39) A112S probably damaging Het
Prkcq T C 2: 11,304,221 (GRCm39) F651S probably damaging Het
Rnf148 A C 6: 23,654,979 (GRCm39) S6A probably benign Het
Selenoi A G 5: 30,471,926 (GRCm39) I376V possibly damaging Het
Skint6 A T 4: 113,034,243 (GRCm39) probably null Het
Tdrd6 T C 17: 43,938,817 (GRCm39) T744A probably benign Het
Tet2 T A 3: 133,172,509 (GRCm39) T1918S possibly damaging Het
Ttc28 C A 5: 111,371,995 (GRCm39) L846M probably damaging Het
Ubxn2a A T 12: 4,933,832 (GRCm39) V193D possibly damaging Het
Umodl1 T A 17: 31,207,031 (GRCm39) C807* probably null Het
Upf2 T A 2: 5,978,347 (GRCm39) S404T unknown Het
Urb1 CACTTAC CAC 16: 90,569,461 (GRCm39) probably benign Het
Usp53 A T 3: 122,743,467 (GRCm39) S490T probably benign Het
Wscd1 T C 11: 71,650,799 (GRCm39) L42P possibly damaging Het
Xirp2 T C 2: 67,344,842 (GRCm39) I2361T probably benign Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34,229,191 (GRCm39) missense probably damaging 0.98
IGL01802:Acta2 APN 19 34,220,836 (GRCm39) missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34,229,254 (GRCm39) missense probably benign 0.03
IGL02136:Acta2 APN 19 34,229,230 (GRCm39) missense probably damaging 1.00
IGL03114:Acta2 APN 19 34,222,310 (GRCm39) critical splice donor site probably null
R0648:Acta2 UTSW 19 34,225,934 (GRCm39) missense probably benign
R1393:Acta2 UTSW 19 34,219,192 (GRCm39) missense probably damaging 1.00
R1597:Acta2 UTSW 19 34,229,983 (GRCm39) splice site probably benign
R2045:Acta2 UTSW 19 34,220,799 (GRCm39) missense probably damaging 1.00
R2338:Acta2 UTSW 19 34,225,941 (GRCm39) splice site probably benign
R3113:Acta2 UTSW 19 34,220,752 (GRCm39) missense probably benign
R3940:Acta2 UTSW 19 34,220,880 (GRCm39) missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34,229,126 (GRCm39) splice site probably benign
R4765:Acta2 UTSW 19 34,223,552 (GRCm39) missense probably damaging 1.00
R4826:Acta2 UTSW 19 34,229,223 (GRCm39) nonsense probably null
R6453:Acta2 UTSW 19 34,224,057 (GRCm39) missense probably damaging 1.00
R6754:Acta2 UTSW 19 34,222,383 (GRCm39) missense probably damaging 1.00
R6941:Acta2 UTSW 19 34,229,922 (GRCm39) missense probably damaging 1.00
R7311:Acta2 UTSW 19 34,219,186 (GRCm39) missense probably damaging 1.00
R7461:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7463:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7464:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7536:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7537:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7605:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7609:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7610:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7611:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7626:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7627:Acta2 UTSW 19 34,229,931 (GRCm39) missense probably benign 0.00
R7803:Acta2 UTSW 19 34,220,818 (GRCm39) missense probably benign
R7872:Acta2 UTSW 19 34,220,839 (GRCm39) missense probably damaging 0.99
R8801:Acta2 UTSW 19 34,229,207 (GRCm39) missense probably damaging 0.99
R9059:Acta2 UTSW 19 34,219,155 (GRCm39) missense possibly damaging 0.87
R9191:Acta2 UTSW 19 34,222,480 (GRCm39) missense possibly damaging 0.82
R9487:Acta2 UTSW 19 34,225,865 (GRCm39) missense probably damaging 0.99
R9675:Acta2 UTSW 19 34,223,612 (GRCm39) missense
R9776:Acta2 UTSW 19 34,223,481 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACACAGAGGGATCTAGCC -3'
(R):5'- TTTCGGATCATCAAAGGCTTTACAG -3'

Sequencing Primer
(F):5'- AGGGATCTAGCCTAAAGTCTTGTCC -3'
(R):5'- GCTTTACAGCCTAGTGAAAGC -3'
Posted On 2019-10-24