Incidental Mutation 'R7613:Acta2'
ID588746
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Nameactin, alpha 2, smooth muscle, aorta
SynonymsalphaSMA, SMalphaA, 0610041G09Rik, Actvs, a-SMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7613 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34241090-34255336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34252531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 8 (T8I)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: T8I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: T8I

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 CTATA CTATATA 4: 130,021,213 probably benign Het
Adh1 T A 3: 138,286,831 L236* probably null Het
Akt2 A G 7: 27,637,170 I448V probably benign Het
Anapc5 G A 5: 122,818,865 T117M probably damaging Het
Cacna1d A T 14: 30,066,163 D1605E probably benign Het
Celsr2 C T 3: 108,395,640 G2506R probably damaging Het
Cenpe T A 3: 135,242,302 F31L possibly damaging Het
Cenpj G A 14: 56,527,044 R1304* probably null Het
Cfap58 A G 19: 47,982,122 D593G possibly damaging Het
Crip2 T C 12: 113,144,157 probably null Het
Crocc2 G T 1: 93,194,589 A735S possibly damaging Het
Dnah2 A G 11: 69,548,990 probably null Het
Dpp8 C T 9: 65,053,120 T311M possibly damaging Het
Eps15 T C 4: 109,329,725 S330P probably damaging Het
Exoc2 C T 13: 30,882,272 V474I probably benign Het
Foxn2 T C 17: 88,486,883 I416T possibly damaging Het
Gbp8 T C 5: 105,031,014 E145G probably damaging Het
Gm3676 T A 14: 41,643,276 I141L probably benign Het
Gm4131 A G 14: 62,481,089 Y23H possibly damaging Het
Gm884 G T 11: 103,616,290 H1617Q unknown Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdac2 T C 10: 36,989,236 S149P probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Igsf9b A T 9: 27,334,122 R1128S probably benign Het
Invs A G 4: 48,392,668 H294R probably damaging Het
Kansl3 G A 1: 36,343,795 S812F probably damaging Het
Katnbl1 T C 2: 112,409,193 S246P probably benign Het
Kcnt1 A T 2: 25,901,346 H567L probably benign Het
Krt33a A G 11: 100,011,939 I353T probably damaging Het
Lrguk A T 6: 34,101,748 R639S possibly damaging Het
Mcoln2 A T 3: 146,175,544 probably null Het
Myo15 A G 11: 60,505,152 T1438A Het
Myocd A G 11: 65,218,603 L114P probably damaging Het
Nutm1 T C 2: 112,249,239 N777S probably benign Het
Olfr1444 A T 19: 12,861,777 M1L probably benign Het
Pde4b A G 4: 102,255,306 E29G probably damaging Het
Plekhn1 G A 4: 156,224,820 P210S probably benign Het
Por G T 5: 135,729,504 A112S probably damaging Het
Prkcq T C 2: 11,299,410 F651S probably damaging Het
Rnf148 A C 6: 23,654,980 S6A probably benign Het
Selenoi A G 5: 30,266,928 I376V possibly damaging Het
Skint6 A T 4: 113,177,046 probably null Het
Tdrd6 T C 17: 43,627,926 T744A probably benign Het
Tet2 T A 3: 133,466,748 T1918S possibly damaging Het
Ttc28 C A 5: 111,224,129 L846M probably damaging Het
Ubxn2a A T 12: 4,883,832 V193D possibly damaging Het
Umodl1 T A 17: 30,988,057 C807* probably null Het
Upf2 T A 2: 5,973,536 S404T unknown Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Usp53 A T 3: 122,949,818 S490T probably benign Het
Wscd1 T C 11: 71,759,973 L42P possibly damaging Het
Xirp2 T C 2: 67,514,498 I2361T probably benign Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34251791 missense probably damaging 0.98
IGL01802:Acta2 APN 19 34243436 missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34251854 missense probably benign 0.03
IGL02136:Acta2 APN 19 34251830 missense probably damaging 1.00
IGL03114:Acta2 APN 19 34244910 critical splice donor site probably null
R0648:Acta2 UTSW 19 34248534 missense probably benign
R1393:Acta2 UTSW 19 34241792 missense probably damaging 1.00
R1597:Acta2 UTSW 19 34252583 splice site probably benign
R2045:Acta2 UTSW 19 34243399 missense probably damaging 1.00
R2338:Acta2 UTSW 19 34248541 splice site probably benign
R3113:Acta2 UTSW 19 34243352 missense probably benign
R3940:Acta2 UTSW 19 34243480 missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34251726 splice site probably benign
R4765:Acta2 UTSW 19 34246152 missense probably damaging 1.00
R4826:Acta2 UTSW 19 34251823 nonsense probably null
R6453:Acta2 UTSW 19 34246657 missense probably damaging 1.00
R6754:Acta2 UTSW 19 34244983 missense probably damaging 1.00
R6941:Acta2 UTSW 19 34252522 missense probably damaging 1.00
R7311:Acta2 UTSW 19 34241786 missense probably damaging 1.00
R7461:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7463:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7464:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7536:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7537:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7605:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7609:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7610:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7611:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7626:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7627:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7803:Acta2 UTSW 19 34243418 missense probably benign
R7872:Acta2 UTSW 19 34243439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACACAGAGGGATCTAGCC -3'
(R):5'- TTTCGGATCATCAAAGGCTTTACAG -3'

Sequencing Primer
(F):5'- AGGGATCTAGCCTAAAGTCTTGTCC -3'
(R):5'- GCTTTACAGCCTAGTGAAAGC -3'
Posted On2019-10-24