Mutagenetix > Incidental Mutations

Incidental Mutation 'R7614:Arhgef4'

588748

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7614 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 34732235 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1208 (S1208A)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159747] [ENSMUST00000162599]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159747
AA Change: S1208A

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: S1208A

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162599
AA Change: S41A

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: S41A

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
SH3	194	249	3.73e-16	SMART
Pfam:RhoGEF	304	405	1.2e-25	PFAM
PH	438	546	2.33e-14	SMART

Meta Mutation Damage Score

0.0753

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	A	3: 108,542,532	D42E	probably benign	Het
Abl2	A	G	1: 156,636,859	T535A	possibly damaging	Het
Adcy9	A	T	16: 4,418,224	L441Q	probably damaging	Het
Adgrv1	A	T	13: 81,520,661	V2592E	probably damaging	Het
Ahdc1	A	G	4: 133,063,514	S689G	probably benign	Het
Ankrd24	G	A	10: 81,638,689	G229E	unknown	Het
Ankrd34c	T	A	9: 89,728,861	I476F	probably damaging	Het
Arhgap8	A	G	15: 84,757,075	T181A	probably benign	Het
Arhgef19	A	G	4: 141,256,779	H770R	possibly damaging	Het
Arid1a	A	T	4: 133,691,155	M654K	unknown	Het
Atp11b	T	A	3: 35,810,110		probably null	Het
Cadps	A	G	14: 12,454,260	I1086T	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cntn3	T	C	6: 102,165,376	H1010R	probably benign	Het
Cyp2c66	T	A	19: 39,171,028	Y308N	probably damaging	Het
Dok6	T	A	18: 89,473,943	H170L	probably damaging	Het
Eefsec	C	T	6: 88,281,594	D506N	possibly damaging	Het
Fam181a	C	T	12: 103,316,546	P237S	probably damaging	Het
Fam186b	T	C	15: 99,286,986	I19V	probably damaging	Het
Gm3285	A	T	10: 77,862,031	T5S	unknown	Het
Heg1	A	G	16: 33,727,363	E864G	probably benign	Het
Herc2	T	A	7: 56,153,275	L2124*	probably null	Het
Hexa	T	C	9: 59,561,947	S331P	probably damaging	Het
Hspb1	A	T	5: 135,888,369	D104V	probably damaging	Het
Ikzf1	A	T	11: 11,769,019	Q329L	probably damaging	Het
Kcnf1	C	A	12: 17,174,786	R478L	probably benign	Het
Kdm3a	T	C	6: 71,591,953	T1161A	possibly damaging	Het
Krtap31-2	T	C	11: 99,936,603	I87T	possibly damaging	Het
Lars2	T	C	9: 123,395,111	S116P		Het
Lrrk2	A	G	15: 91,772,858	D1785G	probably damaging	Het
Myo10	A	G	15: 25,701,623	H61R	probably benign	Het
Olfr12	A	G	1: 92,620,461	Y185C	probably damaging	Het
Olfr248	T	G	1: 174,391,654	F195C	probably damaging	Het
Pcdhb4	C	A	18: 37,309,549	H637Q	probably benign	Het
Pcsk9	T	A	4: 106,447,566	D435V	probably benign	Het
Prickle2	T	A	6: 92,425,650	Y119F	possibly damaging	Het
Psd	T	A	19: 46,313,438	Q903L	probably damaging	Het
Ptpn13	T	A	5: 103,501,465	S245T	probably benign	Het
Resp18	T	C	1: 75,278,238	S24G	probably damaging	Het
Slc17a4	T	C	13: 23,906,597	T89A	probably benign	Het
Slc9a9	A	G	9: 94,855,739	Y233C	probably damaging	Het
Slit1	T	A	19: 41,634,200	I707F	probably damaging	Het
Sp4	T	C	12: 118,254,439	E691G	possibly damaging	Het
Sun2	G	T	15: 79,739,024		probably null	Het
Syne3	T	C	12: 104,946,642	T723A	not run	Het
Tcp1	T	A	17: 12,922,653	F340I	possibly damaging	Het
Tmem39b	A	T	4: 129,693,901	V39D	probably damaging	Het
Tmtc3	A	T	10: 100,450,352	Y536*	probably null	Het
Tnfrsf11a	A	T	1: 105,827,369	T389S	probably damaging	Het
Ttn	T	C	2: 76,768,529	T19347A	possibly damaging	Het
Vmn1r68	A	G	7: 10,527,626	S182P	probably benign	Het
Vmn2r95	A	G	17: 18,440,090	T255A	probably benign	Het
Wdr59	T	C	8: 111,492,762	Y221C		Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCGCCAGTTGATTTATGCTCAC -3'
(R):5'- AAGCATCCAGGCCATGTCAG -3'

Sequencing Primer
(F):5'- GCCAGTTGATTTATGCTCACTCTGG -3'
(R):5'- CAGCTTACCTGAACTGGGTC -3'

Posted On

2019-10-24