Incidental Mutation 'R7614:Tnfrsf11a'
ID588751
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7614 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105827369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 389 (T389S)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: T389S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: T389S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,532 D42E probably benign Het
Abl2 A G 1: 156,636,859 T535A possibly damaging Het
Adcy9 A T 16: 4,418,224 L441Q probably damaging Het
Adgrv1 A T 13: 81,520,661 V2592E probably damaging Het
Ahdc1 A G 4: 133,063,514 S689G probably benign Het
Ankrd24 G A 10: 81,638,689 G229E unknown Het
Ankrd34c T A 9: 89,728,861 I476F probably damaging Het
Arhgap8 A G 15: 84,757,075 T181A probably benign Het
Arhgef19 A G 4: 141,256,779 H770R possibly damaging Het
Arhgef4 T G 1: 34,732,235 S1208A possibly damaging Het
Arid1a A T 4: 133,691,155 M654K unknown Het
Cadps A G 14: 12,454,260 I1086T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntn3 T C 6: 102,165,376 H1010R probably benign Het
Cyp2c66 T A 19: 39,171,028 Y308N probably damaging Het
Dok6 T A 18: 89,473,943 H170L probably damaging Het
Eefsec C T 6: 88,281,594 D506N possibly damaging Het
Fam181a C T 12: 103,316,546 P237S probably damaging Het
Fam186b T C 15: 99,286,986 I19V probably damaging Het
Gm3285 A T 10: 77,862,031 T5S unknown Het
Heg1 A G 16: 33,727,363 E864G probably benign Het
Herc2 T A 7: 56,153,275 L2124* probably null Het
Hexa T C 9: 59,561,947 S331P probably damaging Het
Hspb1 A T 5: 135,888,369 D104V probably damaging Het
Ikzf1 A T 11: 11,769,019 Q329L probably damaging Het
Kcnf1 C A 12: 17,174,786 R478L probably benign Het
Kdm3a T C 6: 71,591,953 T1161A possibly damaging Het
Krtap31-2 T C 11: 99,936,603 I87T possibly damaging Het
Lars2 T C 9: 123,395,111 S116P Het
Lrrk2 A G 15: 91,772,858 D1785G probably damaging Het
Myo10 A G 15: 25,701,623 H61R probably benign Het
Olfr12 A G 1: 92,620,461 Y185C probably damaging Het
Olfr248 T G 1: 174,391,654 F195C probably damaging Het
Pcdhb4 C A 18: 37,309,549 H637Q probably benign Het
Pcsk9 T A 4: 106,447,566 D435V probably benign Het
Prickle2 T A 6: 92,425,650 Y119F possibly damaging Het
Psd T A 19: 46,313,438 Q903L probably damaging Het
Ptpn13 T A 5: 103,501,465 S245T probably benign Het
Resp18 T C 1: 75,278,238 S24G probably damaging Het
Slc17a4 T C 13: 23,906,597 T89A probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Slit1 T A 19: 41,634,200 I707F probably damaging Het
Sp4 T C 12: 118,254,439 E691G possibly damaging Het
Syne3 T C 12: 104,946,642 T723A not run Het
Tcp1 T A 17: 12,922,653 F340I possibly damaging Het
Tmem39b A T 4: 129,693,901 V39D probably damaging Het
Tmtc3 A T 10: 100,450,352 Y536* probably null Het
Ttn T C 2: 76,768,529 T19347A possibly damaging Het
Vmn1r68 A G 7: 10,527,626 S182P probably benign Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Wdr59 T C 8: 111,492,762 Y221C Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7323:Tnfrsf11a UTSW 1 105844730 missense probably damaging 1.00
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
R7607:Tnfrsf11a UTSW 1 105844732 missense probably benign 0.02
R7651:Tnfrsf11a UTSW 1 105809446 missense probably damaging 1.00
R7908:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
R7989:Tnfrsf11a UTSW 1 105809374 missense probably damaging 1.00
Z1177:Tnfrsf11a UTSW 1 105826999 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTAGGACGTTCACACTGGTC -3'
(R):5'- GAAAGGGTTCATGGTCCTCC -3'

Sequencing Primer
(F):5'- TCACACTGGTCAGCGAGGTTG -3'
(R):5'- GTTCATGGTCCTCCCCAGG -3'
Posted On2019-10-24