Incidental Mutation 'R0233:Rgs12'
ID58877
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Nameregulator of G-protein signaling 12
Synonyms1200016K18Rik, 4632412M04Rik
MMRRC Submission 038474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R0233 (G1)
Quality Score161
Status Validated
Chromosome5
Chromosomal Location34949445-35039644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35030498 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 500 (S500T)
Ref Sequence ENSEMBL: ENSMUSP00000109924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684] [ENSMUST00000114280] [ENSMUST00000114281] [ENSMUST00000114283] [ENSMUST00000114284] [ENSMUST00000114285]
Predicted Effect probably damaging
Transcript: ENSMUST00000030984
AA Change: S1148T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: S1148T

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: S1148T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: S1148T

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114280
SMART Domains Protein: ENSMUSP00000109919
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114281
AA Change: S490T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109920
Gene: ENSMUSG00000029101
AA Change: S490T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 701 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114283
AA Change: S490T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101
AA Change: S490T

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114284
AA Change: S500T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109923
Gene: ENSMUSG00000029101
AA Change: S500T

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 711 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114285
AA Change: S500T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101
AA Change: S500T

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155162
Predicted Effect probably benign
Transcript: ENSMUST00000156819
SMART Domains Protein: ENSMUSP00000116913
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
RBD 21 91 3.12e-28 SMART
RBD 93 163 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202914
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,663,373 S212P probably benign Het
4932438A13Rik T A 3: 36,948,563 C1552* probably null Het
A730018C14Rik A C 12: 112,415,430 noncoding transcript Het
Acsf3 A G 8: 122,780,292 Y108C probably damaging Het
Acsl1 A G 8: 46,513,569 probably benign Het
Adad1 T A 3: 37,084,948 I389N possibly damaging Het
Ankrd27 T C 7: 35,601,560 L95P probably damaging Het
Ano5 T C 7: 51,535,470 F46S possibly damaging Het
Ap2a1 T C 7: 44,915,973 N114S probably damaging Het
Arap1 C T 7: 101,400,241 S970L possibly damaging Het
Atad3a A T 4: 155,746,067 S525T probably damaging Het
B4galnt1 T C 10: 127,170,911 probably benign Het
Cacna2d2 A T 9: 107,514,670 I463F probably damaging Het
Casp6 T A 3: 129,905,975 N34K probably damaging Het
Ccdc175 A T 12: 72,105,876 F752I probably benign Het
Cdhr4 A G 9: 107,996,934 I76V probably benign Het
Copa T C 1: 172,087,667 probably null Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
Cuzd1 C A 7: 131,311,816 K357N possibly damaging Het
Dnah5 T A 15: 28,333,070 F2206I probably damaging Het
Dnase2b T A 3: 146,582,550 K263N probably benign Het
Dync1h1 T A 12: 110,640,980 D2668E probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam124b T C 1: 80,212,986 S227G probably damaging Het
Fam13b T A 18: 34,448,084 Y675F probably damaging Het
Fgf21 T A 7: 45,615,297 M4L probably benign Het
Flg2 T A 3: 93,201,797 C377* probably null Het
Foxp2 T C 6: 15,409,753 S451P probably damaging Het
Gli2 A T 1: 118,835,925 S1499T probably damaging Het
Gm13078 A T 4: 143,726,063 E21D possibly damaging Het
Gm8909 A G 17: 36,167,469 Y224H probably benign Het
Gm9920 A T 15: 55,112,461 probably benign Het
Gpx5 T A 13: 21,287,403 D210V probably damaging Het
Hoxb5 T A 11: 96,305,027 S234T probably benign Het
Irf9 C A 14: 55,606,094 N140K probably benign Het
Isg20 C T 7: 78,914,495 T50M probably damaging Het
Isg20 C A 7: 78,916,586 D94E probably damaging Het
Izumo1 T C 7: 45,624,168 L115P probably damaging Het
Kdm3b G A 18: 34,809,420 E655K probably damaging Het
Kdm5b T G 1: 134,604,634 probably benign Het
Kifc3 A G 8: 95,101,472 probably null Het
Kpna2 T C 11: 106,992,631 S111G probably benign Het
Krt73 A T 15: 101,802,016 N94K probably benign Het
Lgmn G T 12: 102,399,989 D247E probably damaging Het
Lilra6 C T 7: 3,914,936 V70I possibly damaging Het
Lrig3 G A 10: 126,013,526 probably null Het
Lrrc4 T C 6: 28,829,735 H627R probably benign Het
Macf1 G A 4: 123,450,127 probably benign Het
Nat9 C A 11: 115,183,408 probably null Het
Nutm2 A G 13: 50,467,405 D2G probably benign Het
Olfr1151 A G 2: 87,857,752 I192M probably benign Het
Olfr1404 A T 1: 173,216,301 I217F probably benign Het
Olfr191 A T 16: 59,085,675 D269E probably benign Het
Parl G A 16: 20,287,907 P184L probably damaging Het
Pdzd8 A T 19: 59,300,379 M863K probably damaging Het
Phlda3 T C 1: 135,766,821 S125P probably damaging Het
Pkd1l3 A T 8: 109,650,780 R217* probably null Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Prg4 T C 1: 150,453,547 probably benign Het
Prkab1 A G 5: 116,021,652 probably benign Het
Pyroxd1 A G 6: 142,354,630 E162G possibly damaging Het
R3hcc1l G A 19: 42,582,921 probably null Het
Ripor3 T C 2: 167,992,598 D299G probably damaging Het
Robo4 T C 9: 37,402,681 L76P probably damaging Het
Sbno1 T C 5: 124,376,226 Y1302C probably damaging Het
Sec63 A G 10: 42,823,908 I655V possibly damaging Het
Serpina11 T A 12: 103,980,470 M389L probably benign Het
Sfswap C A 5: 129,554,543 P745Q possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slitrk3 C T 3: 73,048,577 S954N probably benign Het
Sorbs2 A G 8: 45,769,829 T190A probably damaging Het
Sos2 A T 12: 69,617,330 I460N probably benign Het
Spink7 T A 18: 62,594,352 I34L probably benign Het
Srbd1 A G 17: 86,057,745 S628P probably damaging Het
Srm G A 4: 148,593,372 G156S probably damaging Het
Sulf2 T C 2: 166,085,669 probably benign Het
Tmc4 T A 7: 3,666,867 Y6F probably benign Het
Tmcc2 A G 1: 132,360,651 F433L probably damaging Het
Tmprss13 T G 9: 45,337,100 probably benign Het
Tnxb T C 17: 34,699,033 F2307L probably benign Het
Tsr3 A G 17: 25,242,510 E274G probably benign Het
Ttn T C 2: 76,895,144 probably benign Het
Tub T C 7: 109,029,341 V352A possibly damaging Het
Tubb2a A G 13: 34,075,342 I155T possibly damaging Het
Ugt2a2 T C 5: 87,475,001 N36S probably damaging Het
Usp13 T A 3: 32,915,664 probably null Het
Vmn1r52 T G 6: 90,179,611 L120R possibly damaging Het
Vmn2r11 A T 5: 109,054,102 S179T probably benign Het
Vwf A T 6: 125,686,510 R2805W possibly damaging Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp286 T C 11: 62,780,393 T285A possibly damaging Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 34975219 missense probably benign 0.25
IGL02296:Rgs12 APN 5 34966120 missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35020353 missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35030517 missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35025883 missense probably damaging 0.97
IGL02989:Rgs12 APN 5 34965119 missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0015:Rgs12 UTSW 5 35022776 unclassified probably benign
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0046:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0106:Rgs12 UTSW 5 34966664 missense probably benign 0.03
R0233:Rgs12 UTSW 5 35030498 missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35030080 missense probably benign 0.01
R0611:Rgs12 UTSW 5 35019460 missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35023122 missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35024366 unclassified probably benign
R1174:Rgs12 UTSW 5 34966465 missense probably benign 0.00
R1538:Rgs12 UTSW 5 35021167 missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35039282 missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 34966403 missense probably benign 0.34
R1791:Rgs12 UTSW 5 34966112 missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 34965674 missense probably damaging 1.00
R1872:Rgs12 UTSW 5 34965821 missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35032269 missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35030528 missense probably benign 0.00
R2107:Rgs12 UTSW 5 34966735 missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35032251 missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35032354 missense probably damaging 1.00
R3826:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 34966015 missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35032311 missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35020356 missense probably damaging 1.00
R5132:Rgs12 UTSW 5 34989812 intron probably benign
R5213:Rgs12 UTSW 5 34965320 missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35021104 unclassified probably benign
R5480:Rgs12 UTSW 5 34966111 missense probably benign 0.09
R5510:Rgs12 UTSW 5 34966039 missense probably damaging 1.00
R5708:Rgs12 UTSW 5 34966352 missense probably benign 0.41
R5987:Rgs12 UTSW 5 35020345 missense probably damaging 1.00
R6053:Rgs12 UTSW 5 34965952 missense probably benign 0.01
R6113:Rgs12 UTSW 5 35020323 missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35020332 missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35023092 missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35023171 missense probably null 0.27
R6857:Rgs12 UTSW 5 35030022 nonsense probably null
R7082:Rgs12 UTSW 5 34966706 missense probably benign 0.00
R7250:Rgs12 UTSW 5 34965497 missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35026371 missense probably benign 0.06
R7444:Rgs12 UTSW 5 35025943 missense possibly damaging 0.65
R7632:Rgs12 UTSW 5 34965590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCAGAAACCACTTGGCTATG -3'
(R):5'- TGCAACAAGGACCAGGCTATGAC -3'

Sequencing Primer
(F):5'- GAAACCACTTGGCTATGGTAATTCC -3'
(R):5'- AGCAGGTTTAAGGACTGTACTG -3'
Posted On2013-07-11