Incidental Mutation 'R7614:Hexa'
ID588771
Institutional Source Beutler Lab
Gene Symbol Hexa
Ensembl Gene ENSMUSG00000025232
Gene Namehexosaminidase A
SynonymsHex-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7614 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location59539540-59565109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59561947 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 331 (S331P)
Ref Sequence ENSEMBL: ENSMUSP00000026262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026262]
Predicted Effect probably damaging
Transcript: ENSMUST00000026262
AA Change: S331P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026262
Gene: ENSMUSG00000025232
AA Change: S331P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Glycohydro_20b2 23 145 3e-25 PFAM
Pfam:Glyco_hydro_20 167 487 1.6e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the glycosyl hydrolase 20 family of proteins. The encoded preproprotein is proteolytically processed to generate the alpha subunit of the lysosomal enzyme beta-hexosaminidase. This enzyme, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mice lacking the encoded protein exhibit accumulation of gangliosides in the brain and membranous cytoplasmic bodies in neurons. Certain mutations in the human ortholog of this gene cause Tay-Sachs disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants accumulate excess amounts of GM2 ganglioside that is stored in neurons as membranous cytoplasmic bodies typically seen in the neurons of Tay-Sachs disease patients. However, the mutant mice appear to be functionally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,532 D42E probably benign Het
Abl2 A G 1: 156,636,859 T535A possibly damaging Het
Adcy9 A T 16: 4,418,224 L441Q probably damaging Het
Adgrv1 A T 13: 81,520,661 V2592E probably damaging Het
Ahdc1 A G 4: 133,063,514 S689G probably benign Het
Ankrd24 G A 10: 81,638,689 G229E unknown Het
Ankrd34c T A 9: 89,728,861 I476F probably damaging Het
Arhgap8 A G 15: 84,757,075 T181A probably benign Het
Arhgef19 A G 4: 141,256,779 H770R possibly damaging Het
Arhgef4 T G 1: 34,732,235 S1208A possibly damaging Het
Arid1a A T 4: 133,691,155 M654K unknown Het
Atp11b T A 3: 35,810,110 probably null Het
Cadps A G 14: 12,454,260 I1086T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntn3 T C 6: 102,165,376 H1010R probably benign Het
Cyp2c66 T A 19: 39,171,028 Y308N probably damaging Het
Dok6 T A 18: 89,473,943 H170L probably damaging Het
Eefsec C T 6: 88,281,594 D506N possibly damaging Het
Fam181a C T 12: 103,316,546 P237S probably damaging Het
Fam186b T C 15: 99,286,986 I19V probably damaging Het
Gm3285 A T 10: 77,862,031 T5S unknown Het
Heg1 A G 16: 33,727,363 E864G probably benign Het
Herc2 T A 7: 56,153,275 L2124* probably null Het
Hspb1 A T 5: 135,888,369 D104V probably damaging Het
Ikzf1 A T 11: 11,769,019 Q329L probably damaging Het
Kcnf1 C A 12: 17,174,786 R478L probably benign Het
Kdm3a T C 6: 71,591,953 T1161A possibly damaging Het
Krtap31-2 T C 11: 99,936,603 I87T possibly damaging Het
Lars2 T C 9: 123,395,111 S116P Het
Lrrk2 A G 15: 91,772,858 D1785G probably damaging Het
Myo10 A G 15: 25,701,623 H61R probably benign Het
Olfr12 A G 1: 92,620,461 Y185C probably damaging Het
Olfr248 T G 1: 174,391,654 F195C probably damaging Het
Pcdhb4 C A 18: 37,309,549 H637Q probably benign Het
Pcsk9 T A 4: 106,447,566 D435V probably benign Het
Prickle2 T A 6: 92,425,650 Y119F possibly damaging Het
Psd T A 19: 46,313,438 Q903L probably damaging Het
Ptpn13 T A 5: 103,501,465 S245T probably benign Het
Resp18 T C 1: 75,278,238 S24G probably damaging Het
Slc17a4 T C 13: 23,906,597 T89A probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Slit1 T A 19: 41,634,200 I707F probably damaging Het
Sp4 T C 12: 118,254,439 E691G possibly damaging Het
Sun2 G T 15: 79,739,024 probably null Het
Syne3 T C 12: 104,946,642 T723A not run Het
Tcp1 T A 17: 12,922,653 F340I possibly damaging Het
Tmem39b A T 4: 129,693,901 V39D probably damaging Het
Tmtc3 A T 10: 100,450,352 Y536* probably null Het
Tnfrsf11a A T 1: 105,827,369 T389S probably damaging Het
Ttn T C 2: 76,768,529 T19347A possibly damaging Het
Vmn1r68 A G 7: 10,527,626 S182P probably benign Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Wdr59 T C 8: 111,492,762 Y221C Het
Other mutations in Hexa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Hexa APN 9 59563880 splice site probably benign
IGL02078:Hexa APN 9 59557303 missense probably benign 0.36
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0098:Hexa UTSW 9 59558100 missense probably damaging 1.00
R0281:Hexa UTSW 9 59554226 critical splice donor site probably null
R0364:Hexa UTSW 9 59563935 missense probably benign 0.00
R0481:Hexa UTSW 9 59555410 splice site probably benign
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R1888:Hexa UTSW 9 59557303 missense probably benign 0.36
R2264:Hexa UTSW 9 59555377 missense probably damaging 0.99
R3545:Hexa UTSW 9 59557298 missense probably damaging 0.99
R4609:Hexa UTSW 9 59557319 missense probably benign 0.32
R5777:Hexa UTSW 9 59560960 missense probably damaging 0.99
R6041:Hexa UTSW 9 59563236 missense probably damaging 0.99
R6403:Hexa UTSW 9 59557361 missense probably damaging 1.00
R6776:Hexa UTSW 9 59558072 missense probably damaging 1.00
R6805:Hexa UTSW 9 59563937 missense possibly damaging 0.55
R6912:Hexa UTSW 9 59539938 missense probably damaging 1.00
R7285:Hexa UTSW 9 59563939 missense probably benign 0.02
R7467:Hexa UTSW 9 59557400 critical splice donor site probably null
R7556:Hexa UTSW 9 59563299 missense probably damaging 1.00
R7574:Hexa UTSW 9 59563984 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAATGGAAGGCGCGTTCTCC -3'
(R):5'- CTCGGGACTGACTTTGGTAC -3'

Sequencing Primer
(F):5'- TGAGACTCCTCAAGATCAGGC -3'
(R):5'- CTTTGGTACTGAGAGCAGACACC -3'
Posted On2019-10-24