Mutagenetix > Incidental Mutations

Incidental Mutation 'R7614:Vmn2r95'

588794

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r95

Ensembl Gene

ENSMUSG00000091631

Gene Name

vomeronasal 2, receptor 95

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R7614 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18424078-18460905 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18440090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 255 (T255A)

Ref Sequence

ENSEMBL: ENSMUSP00000126106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]

AlphaFold

A0A338P6T0

Predicted Effect

probably benign
Transcript: ENSMUST00000166327
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: T255A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	462	1.8e-35	PFAM
Pfam:NCD3G	509	562	3.2e-20	PFAM
Pfam:7tm_3	594	830	3.2e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000232090
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000232464
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	A	3: 108,542,532	D42E	probably benign	Het
Abl2	A	G	1: 156,636,859	T535A	possibly damaging	Het
Adcy9	A	T	16: 4,418,224	L441Q	probably damaging	Het
Adgrv1	A	T	13: 81,520,661	V2592E	probably damaging	Het
Ahdc1	A	G	4: 133,063,514	S689G	probably benign	Het
Ankrd24	G	A	10: 81,638,689	G229E	unknown	Het
Ankrd34c	T	A	9: 89,728,861	I476F	probably damaging	Het
Arhgap8	A	G	15: 84,757,075	T181A	probably benign	Het
Arhgef19	A	G	4: 141,256,779	H770R	possibly damaging	Het
Arhgef4	T	G	1: 34,732,235	S1208A	possibly damaging	Het
Arid1a	A	T	4: 133,691,155	M654K	unknown	Het
Atp11b	T	A	3: 35,810,110		probably null	Het
Cadps	A	G	14: 12,454,260	I1086T	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cntn3	T	C	6: 102,165,376	H1010R	probably benign	Het
Cyp2c66	T	A	19: 39,171,028	Y308N	probably damaging	Het
Dok6	T	A	18: 89,473,943	H170L	probably damaging	Het
Eefsec	C	T	6: 88,281,594	D506N	possibly damaging	Het
Fam181a	C	T	12: 103,316,546	P237S	probably damaging	Het
Fam186b	T	C	15: 99,286,986	I19V	probably damaging	Het
Gm3285	A	T	10: 77,862,031	T5S	unknown	Het
Heg1	A	G	16: 33,727,363	E864G	probably benign	Het
Herc2	T	A	7: 56,153,275	L2124*	probably null	Het
Hexa	T	C	9: 59,561,947	S331P	probably damaging	Het
Hspb1	A	T	5: 135,888,369	D104V	probably damaging	Het
Ikzf1	A	T	11: 11,769,019	Q329L	probably damaging	Het
Kcnf1	C	A	12: 17,174,786	R478L	probably benign	Het
Kdm3a	T	C	6: 71,591,953	T1161A	possibly damaging	Het
Krtap31-2	T	C	11: 99,936,603	I87T	possibly damaging	Het
Lars2	T	C	9: 123,395,111	S116P		Het
Lrrk2	A	G	15: 91,772,858	D1785G	probably damaging	Het
Myo10	A	G	15: 25,701,623	H61R	probably benign	Het
Olfr12	A	G	1: 92,620,461	Y185C	probably damaging	Het
Olfr248	T	G	1: 174,391,654	F195C	probably damaging	Het
Pcdhb4	C	A	18: 37,309,549	H637Q	probably benign	Het
Pcsk9	T	A	4: 106,447,566	D435V	probably benign	Het
Prickle2	T	A	6: 92,425,650	Y119F	possibly damaging	Het
Psd	T	A	19: 46,313,438	Q903L	probably damaging	Het
Ptpn13	T	A	5: 103,501,465	S245T	probably benign	Het
Resp18	T	C	1: 75,278,238	S24G	probably damaging	Het
Slc17a4	T	C	13: 23,906,597	T89A	probably benign	Het
Slc9a9	A	G	9: 94,855,739	Y233C	probably damaging	Het
Slit1	T	A	19: 41,634,200	I707F	probably damaging	Het
Sp4	T	C	12: 118,254,439	E691G	possibly damaging	Het
Sun2	G	T	15: 79,739,024		probably null	Het
Syne3	T	C	12: 104,946,642	T723A	not run	Het
Tcp1	T	A	17: 12,922,653	F340I	possibly damaging	Het
Tmem39b	A	T	4: 129,693,901	V39D	probably damaging	Het
Tmtc3	A	T	10: 100,450,352	Y536*	probably null	Het
Tnfrsf11a	A	T	1: 105,827,369	T389S	probably damaging	Het
Ttn	T	C	2: 76,768,529	T19347A	possibly damaging	Het
Vmn1r68	A	G	7: 10,527,626	S182P	probably benign	Het
Wdr59	T	C	8: 111,492,762	Y221C		Het

Other mutations in Vmn2r95

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Vmn2r95	APN	17	18452328	utr 3 prime	probably benign
IGL01479:Vmn2r95	APN	17	18443862	missense	probably damaging	1.00
IGL01890:Vmn2r95	APN	17	18451475	missense	probably damaging	1.00
IGL01986:Vmn2r95	APN	17	18440211	missense	probably benign	0.06
IGL02113:Vmn2r95	APN	17	18439907	missense	possibly damaging	0.47
IGL02154:Vmn2r95	APN	17	18451986	missense	probably benign	0.16
IGL02190:Vmn2r95	APN	17	18451776	missense	probably benign	0.00
IGL02412:Vmn2r95	APN	17	18439956	missense	probably damaging	1.00
IGL02550:Vmn2r95	APN	17	18451732	missense	probably damaging	1.00
IGL02679:Vmn2r95	APN	17	18443854	missense	probably damaging	1.00
IGL02691:Vmn2r95	APN	17	18451858	missense	probably benign	0.07
IGL02990:Vmn2r95	APN	17	18452036	nonsense	probably null
IGL03032:Vmn2r95	APN	17	18452313	missense	probably benign	0.00
R0416:Vmn2r95	UTSW	17	18441402	missense	probably damaging	1.00
R0448:Vmn2r95	UTSW	17	18451743	missense	possibly damaging	0.92
R0514:Vmn2r95	UTSW	17	18451582	missense	probably benign
R0519:Vmn2r95	UTSW	17	18439503	missense	probably damaging	1.00
R0539:Vmn2r95	UTSW	17	18452100	missense	probably damaging	1.00
R1501:Vmn2r95	UTSW	17	18439856	missense	probably damaging	0.99
R1598:Vmn2r95	UTSW	17	18452313	missense	probably benign	0.03
R1613:Vmn2r95	UTSW	17	18440639	splice site	probably benign
R1861:Vmn2r95	UTSW	17	18452268	missense	probably damaging	1.00
R1921:Vmn2r95	UTSW	17	18424313	missense	probably benign	0.11
R1986:Vmn2r95	UTSW	17	18451543	missense	probably benign
R2031:Vmn2r95	UTSW	17	18439455	missense	possibly damaging	0.94
R2040:Vmn2r95	UTSW	17	18441299	missense	probably damaging	1.00
R3608:Vmn2r95	UTSW	17	18439973	missense	possibly damaging	0.47
R3727:Vmn2r95	UTSW	17	18441482	nonsense	probably null
R3953:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R3955:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R3957:Vmn2r95	UTSW	17	18440096	missense	possibly damaging	0.79
R4474:Vmn2r95	UTSW	17	18452245	missense	probably damaging	1.00
R4672:Vmn2r95	UTSW	17	18452151	missense	probably damaging	1.00
R4850:Vmn2r95	UTSW	17	18451653	missense	probably damaging	1.00
R5054:Vmn2r95	UTSW	17	18451446	missense	possibly damaging	0.63
R5178:Vmn2r95	UTSW	17	18440075	missense	probably benign	0.01
R5980:Vmn2r95	UTSW	17	18441362	missense	probably benign
R6183:Vmn2r95	UTSW	17	18443930	missense	probably damaging	0.99
R6276:Vmn2r95	UTSW	17	18451470	missense	possibly damaging	0.96
R6651:Vmn2r95	UTSW	17	18440360	missense	probably damaging	1.00
R6682:Vmn2r95	UTSW	17	18440227	missense	probably damaging	1.00
R6797:Vmn2r95	UTSW	17	18452289	utr 3 prime	probably benign
R6799:Vmn2r95	UTSW	17	18439293	missense	probably damaging	1.00
R6849:Vmn2r95	UTSW	17	18443919	missense	probably damaging	1.00
R6849:Vmn2r95	UTSW	17	18443920	missense	probably damaging	1.00
R6982:Vmn2r95	UTSW	17	18452061	missense	probably damaging	1.00
R7203:Vmn2r95	UTSW	17	18441315	missense	probably benign	0.01
R7226:Vmn2r95	UTSW	17	18451983	missense	possibly damaging	0.90
R7240:Vmn2r95	UTSW	17	18451963	missense	probably benign	0.15
R7383:Vmn2r95	UTSW	17	18440472	missense	probably benign	0.06
R7755:Vmn2r95	UTSW	17	18424105	start codon destroyed	probably null	0.99
R7942:Vmn2r95	UTSW	17	18440267	missense	possibly damaging	0.74
R8355:Vmn2r95	UTSW	17	18440090	missense	probably benign
R8455:Vmn2r95	UTSW	17	18440090	missense	probably benign
R8478:Vmn2r95	UTSW	17	18452282	missense	probably damaging	1.00
R8547:Vmn2r95	UTSW	17	18443899	missense	probably damaging	1.00
R8752:Vmn2r95	UTSW	17	18441476	missense	probably damaging	0.98
R8788:Vmn2r95	UTSW	17	18451528	missense	probably benign	0.09
R8852:Vmn2r95	UTSW	17	18443851	missense	possibly damaging	0.95
R9098:Vmn2r95	UTSW	17	18439905	missense	possibly damaging	0.88
R9202:Vmn2r95	UTSW	17	18424132	missense	probably benign	0.00
R9244:Vmn2r95	UTSW	17	18451927	missense	possibly damaging	0.91
Z1088:Vmn2r95	UTSW	17	18440401	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTATCCTTCTCTCTACCAGATGG -3'
(R):5'- TAGGCTTCCATGGAATGAGTCTAAC -3'

Sequencing Primer
(F):5'- TACCAGATGGCCCCCAAGG -3'
(R):5'- GAGTCTAACATGAAATAGTCAGCTC -3'

Posted On

2019-10-24