Incidental Mutation 'R7614:Dok6'
ID588796
Institutional Source Beutler Lab
Gene Symbol Dok6
Ensembl Gene ENSMUSG00000073514
Gene Namedocking protein 6
SynonymsDok-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7614 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location89301082-89769528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89473943 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 170 (H170L)
Ref Sequence ENSEMBL: ENSMUSP00000095103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097495]
Predicted Effect probably damaging
Transcript: ENSMUST00000097495
AA Change: H170L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095103
Gene: ENSMUSG00000073514
AA Change: H170L

DomainStartEndE-ValueType
PH 8 114 8.99e-7 SMART
PTBI 130 232 4.39e-45 SMART
IRS 135 232 4.87e-41 SMART
low complexity region 316 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DOK6 is a member of the DOK (see DOK1; MIM 602919) family of intracellular adaptors that play a role in the RET (MIM 164761) signaling cascade (Crowder et al., 2004 [PubMed 15286081]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,532 D42E probably benign Het
Abl2 A G 1: 156,636,859 T535A possibly damaging Het
Adcy9 A T 16: 4,418,224 L441Q probably damaging Het
Adgrv1 A T 13: 81,520,661 V2592E probably damaging Het
Ahdc1 A G 4: 133,063,514 S689G probably benign Het
Ankrd24 G A 10: 81,638,689 G229E unknown Het
Ankrd34c T A 9: 89,728,861 I476F probably damaging Het
Arhgap8 A G 15: 84,757,075 T181A probably benign Het
Arhgef19 A G 4: 141,256,779 H770R possibly damaging Het
Arhgef4 T G 1: 34,732,235 S1208A possibly damaging Het
Arid1a A T 4: 133,691,155 M654K unknown Het
Atp11b T A 3: 35,810,110 probably null Het
Cadps A G 14: 12,454,260 I1086T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntn3 T C 6: 102,165,376 H1010R probably benign Het
Cyp2c66 T A 19: 39,171,028 Y308N probably damaging Het
Eefsec C T 6: 88,281,594 D506N possibly damaging Het
Fam181a C T 12: 103,316,546 P237S probably damaging Het
Fam186b T C 15: 99,286,986 I19V probably damaging Het
Gm3285 A T 10: 77,862,031 T5S unknown Het
Heg1 A G 16: 33,727,363 E864G probably benign Het
Herc2 T A 7: 56,153,275 L2124* probably null Het
Hexa T C 9: 59,561,947 S331P probably damaging Het
Hspb1 A T 5: 135,888,369 D104V probably damaging Het
Ikzf1 A T 11: 11,769,019 Q329L probably damaging Het
Kcnf1 C A 12: 17,174,786 R478L probably benign Het
Kdm3a T C 6: 71,591,953 T1161A possibly damaging Het
Krtap31-2 T C 11: 99,936,603 I87T possibly damaging Het
Lars2 T C 9: 123,395,111 S116P Het
Lrrk2 A G 15: 91,772,858 D1785G probably damaging Het
Myo10 A G 15: 25,701,623 H61R probably benign Het
Olfr12 A G 1: 92,620,461 Y185C probably damaging Het
Olfr248 T G 1: 174,391,654 F195C probably damaging Het
Pcdhb4 C A 18: 37,309,549 H637Q probably benign Het
Pcsk9 T A 4: 106,447,566 D435V probably benign Het
Prickle2 T A 6: 92,425,650 Y119F possibly damaging Het
Psd T A 19: 46,313,438 Q903L probably damaging Het
Ptpn13 T A 5: 103,501,465 S245T probably benign Het
Resp18 T C 1: 75,278,238 S24G probably damaging Het
Slc17a4 T C 13: 23,906,597 T89A probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Slit1 T A 19: 41,634,200 I707F probably damaging Het
Sp4 T C 12: 118,254,439 E691G possibly damaging Het
Sun2 G T 15: 79,739,024 probably null Het
Syne3 T C 12: 104,946,642 T723A not run Het
Tcp1 T A 17: 12,922,653 F340I possibly damaging Het
Tmem39b A T 4: 129,693,901 V39D probably damaging Het
Tmtc3 A T 10: 100,450,352 Y536* probably null Het
Tnfrsf11a A T 1: 105,827,369 T389S probably damaging Het
Ttn T C 2: 76,768,529 T19347A possibly damaging Het
Vmn1r68 A G 7: 10,527,626 S182P probably benign Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Wdr59 T C 8: 111,492,762 Y221C Het
Other mutations in Dok6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1884:Dok6 UTSW 18 89474006 missense probably damaging 1.00
R1984:Dok6 UTSW 18 89560110 missense probably damaging 1.00
R2369:Dok6 UTSW 18 89414864 missense probably null 0.00
R2372:Dok6 UTSW 18 89414864 missense probably null 0.00
R4572:Dok6 UTSW 18 89473947 missense possibly damaging 0.95
R4587:Dok6 UTSW 18 89301196 missense probably benign 0.06
R4658:Dok6 UTSW 18 89473847 splice site probably benign
R5241:Dok6 UTSW 18 89598789 missense possibly damaging 0.77
R5995:Dok6 UTSW 18 89421018 missense possibly damaging 0.89
R7498:Dok6 UTSW 18 89769319 start gained probably benign
R7840:Dok6 UTSW 18 89560058 missense probably benign 0.00
R8041:Dok6 UTSW 18 89560089 missense possibly damaging 0.93
R8158:Dok6 UTSW 18 89473947 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCTGTTGCTATGTCAAACTTTCATCAG -3'
(R):5'- GTCAATGGTACCGAGGACTG -3'

Sequencing Primer
(F):5'- AGTTGTGTGATTCATCTGAAACC -3'
(R):5'- TACCGAGGACTGTGAGAACATTTC -3'
Posted On2019-10-24