Incidental Mutation 'R7614:Psd'
ID588799
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7614 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46313438 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 903 (Q903L)
Ref Sequence ENSEMBL: ENSMUSP00000039728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably damaging
Transcript: ENSMUST00000041391
AA Change: Q903L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: Q903L

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073116
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096029
AA Change: Q904L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: Q904L

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111881
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224556
AA Change: Q272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225323
AA Change: Q904L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,532 D42E probably benign Het
Abl2 A G 1: 156,636,859 T535A possibly damaging Het
Adcy9 A T 16: 4,418,224 L441Q probably damaging Het
Adgrv1 A T 13: 81,520,661 V2592E probably damaging Het
Ahdc1 A G 4: 133,063,514 S689G probably benign Het
Ankrd24 G A 10: 81,638,689 G229E unknown Het
Ankrd34c T A 9: 89,728,861 I476F probably damaging Het
Arhgap8 A G 15: 84,757,075 T181A probably benign Het
Arhgef19 A G 4: 141,256,779 H770R possibly damaging Het
Arhgef4 T G 1: 34,732,235 S1208A possibly damaging Het
Arid1a A T 4: 133,691,155 M654K unknown Het
Atp11b T A 3: 35,810,110 probably null Het
Cadps A G 14: 12,454,260 I1086T probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntn3 T C 6: 102,165,376 H1010R probably benign Het
Cyp2c66 T A 19: 39,171,028 Y308N probably damaging Het
Dok6 T A 18: 89,473,943 H170L probably damaging Het
Eefsec C T 6: 88,281,594 D506N possibly damaging Het
Fam181a C T 12: 103,316,546 P237S probably damaging Het
Fam186b T C 15: 99,286,986 I19V probably damaging Het
Gm3285 A T 10: 77,862,031 T5S unknown Het
Heg1 A G 16: 33,727,363 E864G probably benign Het
Herc2 T A 7: 56,153,275 L2124* probably null Het
Hexa T C 9: 59,561,947 S331P probably damaging Het
Hspb1 A T 5: 135,888,369 D104V probably damaging Het
Ikzf1 A T 11: 11,769,019 Q329L probably damaging Het
Kcnf1 C A 12: 17,174,786 R478L probably benign Het
Kdm3a T C 6: 71,591,953 T1161A possibly damaging Het
Krtap31-2 T C 11: 99,936,603 I87T possibly damaging Het
Lars2 T C 9: 123,395,111 S116P Het
Lrrk2 A G 15: 91,772,858 D1785G probably damaging Het
Myo10 A G 15: 25,701,623 H61R probably benign Het
Olfr12 A G 1: 92,620,461 Y185C probably damaging Het
Olfr248 T G 1: 174,391,654 F195C probably damaging Het
Pcdhb4 C A 18: 37,309,549 H637Q probably benign Het
Pcsk9 T A 4: 106,447,566 D435V probably benign Het
Prickle2 T A 6: 92,425,650 Y119F possibly damaging Het
Ptpn13 T A 5: 103,501,465 S245T probably benign Het
Resp18 T C 1: 75,278,238 S24G probably damaging Het
Slc17a4 T C 13: 23,906,597 T89A probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Slit1 T A 19: 41,634,200 I707F probably damaging Het
Sp4 T C 12: 118,254,439 E691G possibly damaging Het
Sun2 G T 15: 79,739,024 probably null Het
Syne3 T C 12: 104,946,642 T723A not run Het
Tcp1 T A 17: 12,922,653 F340I possibly damaging Het
Tmem39b A T 4: 129,693,901 V39D probably damaging Het
Tmtc3 A T 10: 100,450,352 Y536* probably null Het
Tnfrsf11a A T 1: 105,827,369 T389S probably damaging Het
Ttn T C 2: 76,768,529 T19347A possibly damaging Het
Vmn1r68 A G 7: 10,527,626 S182P probably benign Het
Vmn2r95 A G 17: 18,440,090 T255A probably benign Het
Wdr59 T C 8: 111,492,762 Y221C Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2504:Psd UTSW 19 46324913 missense possibly damaging 0.90
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
R7593:Psd UTSW 19 46312913 missense possibly damaging 0.47
Z1177:Psd UTSW 19 46324661 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCCTGTGTGGGAGATACCAAG -3'
(R):5'- CTCTCCCAGGTAGTTCCAAGTG -3'

Sequencing Primer
(F):5'- GGAGATACCAAGGCCCCAGTC -3'
(R):5'- CAGGTAGTTCCAAGTGGCTCAGTC -3'
Posted On2019-10-24