Incidental Mutation 'R7615:Adgrb3'
ID588800
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R7615 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25098897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1192 (V1192I)
Ref Sequence ENSEMBL: ENSMUSP00000035612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: V1192I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126626
AA Change: V322I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: V322I

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: V1192I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146592
AA Change: V952I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: V952I

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: V1192I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Ankhd1 A T 18: 36,656,773 Q466L Het
Auh T C 13: 52,919,013 I111V probably benign Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Mst1r A G 9: 107,920,012 Q1360R probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Scyl3 A T 1: 163,950,338 probably null Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Sh2b3 G A 5: 121,818,700 P333S probably benign Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Synpo G A 18: 60,604,475 T133I probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25221757 splice site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25826391 missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25226754 missense probably benign 0.01
R8886:Adgrb3 UTSW 1 25111847 missense probably damaging 1.00
R8941:Adgrb3 UTSW 1 25094154 missense probably damaging 1.00
R8958:Adgrb3 UTSW 1 25826109 missense possibly damaging 0.68
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCATGTCTAGTGCTTTCTGC -3'
(R):5'- GTCTCTAGGAAATTCTAATTCCCTGAG -3'

Sequencing Primer
(F):5'- GCTGCTATGGTACTCTCAATAATC -3'
(R):5'- CCCTGAGAGTATTGTTTTGCAC -3'
Posted On2019-10-24