Mutagenetix > Incidental Mutation

Incidental Mutation 'R7615:Adgrb3'

588800

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

MMRRC Submission

045683-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.433) question?

Stock #

R7615 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25067476-25829707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25098897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1192 (V1192I)

Ref Sequence

ENSEMBL: ENSMUSP00000035612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

AlphaFold

Q80ZF8

Predicted Effect

probably damaging
Transcript: ENSMUST00000041838
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: V1192I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000126626
AA Change: V322I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: V322I

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	273	7.3e-65	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000135518
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: V1192I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146592
AA Change: V952I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: V952I

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000151309
AA Change: V1192I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: V1192I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	T	C	7: 43,497,849	I320V	possibly damaging	Het
Adat2	A	G	10: 13,553,276	K4R	probably benign	Het
Adgb	G	A	10: 10,436,010	L226F	probably damaging	Het
Ahsa2	T	A	11: 23,496,750	N71I	possibly damaging	Het
Amigo2	T	G	15: 97,245,342	T400P	probably damaging	Het
Ankhd1	A	T	18: 36,656,773	Q466L		Het
Auh	T	C	13: 52,919,013	I111V	probably benign	Het
Brwd1	A	G	16: 96,033,839	F942L	probably damaging	Het
C1qtnf7	A	G	5: 43,616,144	N262D	probably damaging	Het
Cdh9	T	A	15: 16,856,230	S785R	probably damaging	Het
Celsr3	A	G	9: 108,837,652	T2046A	possibly damaging	Het
Cep170b	T	C	12: 112,744,665	V1493A	probably damaging	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Chd2	T	A	7: 73,441,642	H1617L	probably damaging	Het
Clnk	T	C	5: 38,706,698	D404G	probably damaging	Het
Col18a1	C	T	10: 77,067,005	G795D	probably damaging	Het
Csf3r	T	A	4: 126,037,656	Y477*	probably null	Het
Ddx58	T	A	4: 40,229,653	I89F	possibly damaging	Het
Dnah17	T	A	11: 118,110,547	K857*	probably null	Het
Dnah2	T	G	11: 69,435,304	I3674L	probably damaging	Het
Dnah6	A	C	6: 73,095,206	I2431S	possibly damaging	Het
Eml6	T	A	11: 29,802,501	I971F	possibly damaging	Het
Fam135b	A	T	15: 71,463,323	I674N	probably damaging	Het
Fancc	T	A	13: 63,317,558		probably null	Het
Gabrb2	A	C	11: 42,626,742	K464Q	probably benign	Het
Gbp4	T	A	5: 105,122,982	D261V	possibly damaging	Het
Gdf3	A	G	6: 122,606,916	V164A	probably benign	Het
Gm19410	A	G	8: 35,796,359	D978G	probably damaging	Het
Gm20730	C	T	6: 43,081,774	G35R	probably null	Het
Gm9733	A	G	3: 15,320,485	V119A	probably damaging	Het
Grin2b	G	A	6: 135,923,364	T173I	probably damaging	Het
Gtf3c3	A	T	1: 54,423,572	V344E	possibly damaging	Het
Hsd3b5	A	G	3: 98,630,104	I32T	probably damaging	Het
Ido1	G	C	8: 24,593,188	L74V	probably damaging	Het
Igkv1-88	T	A	6: 68,862,373	D85V	probably damaging	Het
Il22ra1	A	G	4: 135,737,459	I159V	probably benign	Het
Iqgap1	A	T	7: 80,730,100	F1175Y	probably damaging	Het
Iqgap1	A	G	7: 80,751,346	V531A	probably benign	Het
Itga1	T	A	13: 114,996,922	Q484L	probably null	Het
Itga11	A	T	9: 62,744,018	E281V	probably benign	Het
Kpna3	T	C	14: 61,372,962	N343S	possibly damaging	Het
Larp1b	A	G	3: 41,033,534	K64E	possibly damaging	Het
Larp1b	A	G	3: 41,035,816	N133S	probably benign	Het
Lctl	T	A	9: 64,122,110	L161H	probably damaging	Het
Mlip	A	G	9: 77,230,483	S381P	probably damaging	Het
Mroh9	A	G	1: 163,046,032	I518T	probably benign	Het
Mst1r	A	G	9: 107,920,012	Q1360R	probably benign	Het
Muc5b	T	A	7: 141,864,892	C3858*	probably null	Het
Naip1	A	T	13: 100,425,776	H960Q	probably benign	Het
Narfl	C	T	17: 25,782,129	P452S	probably benign	Het
Neo1	A	T	9: 58,884,503	S1321T	probably benign	Het
Nid2	C	A	14: 19,802,530	T1102K	probably damaging	Het
Nsmaf	C	T	4: 6,408,563	V739M	probably damaging	Het
Olfr1019	T	A	2: 85,841,657	M45L	probably benign	Het
Olfr1167	T	C	2: 88,149,518	Q167R	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,590	I156T	probably damaging	Het
Olfr727	T	G	14: 50,126,989	S137R	probably benign	Het
Olfr97	T	G	17: 37,231,450	K307Q	probably benign	Het
Osbpl9	G	A	4: 109,086,339	P159S	probably damaging	Het
Parpbp	A	G	10: 88,093,637	S450P	probably damaging	Het
Pdgfrb	A	G	18: 61,064,046	T185A	probably benign	Het
Pkd1	T	C	17: 24,593,502	V3803A	probably damaging	Het
Plau	A	T	14: 20,839,466	K200*	probably null	Het
Plce1	A	T	19: 38,524,665	Q136L	probably benign	Het
Plekhd1	C	T	12: 80,722,445	T493I	probably benign	Het
Pofut1	T	C	2: 153,259,418	S31P	unknown	Het
Prlr	T	A	15: 10,325,924	I243N	probably damaging	Het
Ptgis	A	G	2: 167,223,988	L174P	probably damaging	Het
Ralgapb	T	A	2: 158,450,270	I792K	probably damaging	Het
Retreg3	C	T	11: 101,102,980	S136N	probably damaging	Het
Rnf213	C	T	11: 119,467,297	T4291M		Het
Rtn1	A	G	12: 72,304,143	Y431H	probably damaging	Het
Rwdd3	A	G	3: 121,171,604		probably benign	Het
Scyl3	A	T	1: 163,950,338		probably null	Het
Sh2b2	G	T	5: 136,219,657	Q510K	probably damaging	Het
Sh2b3	G	A	5: 121,818,700	P333S	probably benign	Het
Slc27a6	A	T	18: 58,609,183	N490Y	probably damaging	Het
Slc45a1	C	T	4: 150,638,545	R294Q	probably benign	Het
Sorl1	A	C	9: 41,977,582	I1974S	possibly damaging	Het
Specc1l	C	A	10: 75,263,286	N857K	probably benign	Het
Speg	T	C	1: 75,429,242	L3030P	probably damaging	Het
Spsb1	A	C	4: 149,906,900	D70E	probably benign	Het
Srsf11	A	G	3: 158,016,425	S270P	unknown	Het
Ssr3	A	C	3: 65,387,792	V100G	probably damaging	Het
Synpo	G	A	18: 60,604,475	T133I	probably damaging	Het
Tas2r120	T	G	6: 132,657,810	V285G	probably benign	Het
Tenm4	T	A	7: 96,845,926	V1187D	probably damaging	Het
Tmed8	C	A	12: 87,181,388		probably null	Het
Tmem51	G	A	4: 142,037,564	T61M	probably damaging	Het
Tonsl	A	T	15: 76,630,607	D1132E	probably benign	Het
Tor1aip1	C	T	1: 156,007,584	V358I	possibly damaging	Het
Txlna	A	T	4: 129,630,319	M415K	probably damaging	Het
Tyms	T	A	5: 30,073,560		probably benign	Het
Uggt2	G	T	14: 119,089,269	L177I	probably benign	Het
Uqcrh	T	C	4: 116,069,879	H74R	probably benign	Het
Wnk1	A	T	6: 119,932,738	S33T	probably benign	Het
Zfp553	T	A	7: 127,236,016	C248S	probably damaging	Het
Zfp574	G	A	7: 25,080,576	C341Y	possibly damaging	Het
Zfp729b	T	C	13: 67,591,498	T883A	possibly damaging	Het
Zfp738	T	A	13: 67,670,203	K556N	probably damaging	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25228500	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25074715	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25488119	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25093787	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25112271	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25112171	splice site	probably null
IGL01608:Adgrb3	APN	1	25553774	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25559751	splice site	probably benign
IGL01657:Adgrb3	APN	1	25826493	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25460751	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25826279	missense	probably benign
IGL01767:Adgrb3	APN	1	25559814	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25101431	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25420550	splice site	probably benign
IGL02584:Adgrb3	APN	1	25504984	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25084242	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25504910	splice site	probably null
IGL02929:Adgrb3	APN	1	25553824	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25531897	nonsense	probably null
IGL03165:Adgrb3	APN	1	25094394	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25547475	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25504448	missense	probably damaging	0.99
schwach	UTSW	1	25111691	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25111691	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25221748	splice site	probably benign
R0442:Adgrb3	UTSW	1	25396470	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25547554	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25826199	missense	probably benign
R1252:Adgrb3	UTSW	1	25128828	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25559850	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25488088	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25094183	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25094072	missense	possibly damaging	0.94
R1583:Adgrb3	UTSW	1	25226831	splice site	probably null
R1653:Adgrb3	UTSW	1	25101503	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25826300	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25228471	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25532577	missense	probably damaging	0.99
R1838:Adgrb3	UTSW	1	25084270	missense	probably damaging	1.00
R1869:Adgrb3	UTSW	1	25826438	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25547444	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25111718	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25093957	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25068209	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25111817	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25826454	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25111825	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25094307	nonsense	probably null
R4344:Adgrb3	UTSW	1	25826748	missense	possibly damaging	0.61
R4363:Adgrb3	UTSW	1	25112222	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25831027	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25094366	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25111748	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25826488	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25547532	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25531875	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25221827	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25074779	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25068128	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25826084	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25093952	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25111790	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25094275	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25128859	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25420559	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25826562	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25431501	splice site	probably null
R6006:Adgrb3	UTSW	1	25826531	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25094000	nonsense	probably null
R6183:Adgrb3	UTSW	1	25094370	missense	probably damaging	0.98
R6190:Adgrb3	UTSW	1	25420647	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25432558	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25111718	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25420602	missense	probably benign
R6678:Adgrb3	UTSW	1	25460810	missense	possibly damaging	0.84
R6679:Adgrb3	UTSW	1	25131296	missense	probably benign	0.01
R6685:Adgrb3	UTSW	1	25111736	nonsense	probably null
R6730:Adgrb3	UTSW	1	25094294	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25826172	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25111771	nonsense	probably null
R6953:Adgrb3	UTSW	1	25826511	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25826085	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25131269	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25531876	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25532630	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25531919	nonsense	probably null
R7489:Adgrb3	UTSW	1	25547505	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25547548	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25432544	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25128834	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25420556	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25221757	splice site	probably null
R8161:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25826516	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25488053	missense	probably benign	0.21
R8694:Adgrb3	UTSW	1	25826391	missense	probably damaging	0.98
R8742:Adgrb3	UTSW	1	25226754	missense	probably benign	0.01
R8886:Adgrb3	UTSW	1	25111847	missense	probably damaging	1.00
R8941:Adgrb3	UTSW	1	25094154	missense	probably damaging	1.00
R8958:Adgrb3	UTSW	1	25826109	missense	possibly damaging	0.68
R8979:Adgrb3	UTSW	1	25488034	missense	probably benign	0.03
R9064:Adgrb3	UTSW	1	25531884	missense	possibly damaging	0.86
R9252:Adgrb3	UTSW	1	25826415	missense	probably benign	0.03
R9401:Adgrb3	UTSW	1	25553702	missense	probably damaging	1.00
R9739:Adgrb3	UTSW	1	25553768	missense	probably damaging	1.00
Z1088:Adgrb3	UTSW	1	25131271	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25093914	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GCATGTCTAGTGCTTTCTGC -3'
(R):5'- GTCTCTAGGAAATTCTAATTCCCTGAG -3'

Sequencing Primer
(F):5'- GCTGCTATGGTACTCTCAATAATC -3'
(R):5'- CCCTGAGAGTATTGTTTTGCAC -3'

Posted On

2019-10-24