Incidental Mutation 'R7615:Srsf11'
ID 588816
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Name serine and arginine-rich splicing factor 11
Synonyms Sfrs11, 2610019N13Rik, 0610009J05Rik
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 157716552-157742311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 157722062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000072651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
AlphaFold E9Q6E5
Predicted Effect unknown
Transcript: ENSMUST00000069025
AA Change: S287P
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: S287P

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000072875
AA Change: S270P
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: S270P

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121326
AA Change: S305P
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: S305P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198705
AA Change: S112P
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 157,717,672 (GRCm39) unclassified probably benign
IGL01600:Srsf11 APN 3 157,725,079 (GRCm39) splice site probably benign
IGL02724:Srsf11 APN 3 157,722,068 (GRCm39) unclassified probably benign
IGL03147:Srsf11 UTSW 3 157,732,377 (GRCm39) missense probably damaging 1.00
R0195:Srsf11 UTSW 3 157,742,172 (GRCm39) unclassified probably benign
R0578:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R0580:Srsf11 UTSW 3 157,717,704 (GRCm39) unclassified probably benign
R1075:Srsf11 UTSW 3 157,718,427 (GRCm39) intron probably benign
R1604:Srsf11 UTSW 3 157,724,948 (GRCm39) critical splice donor site probably null
R1797:Srsf11 UTSW 3 157,725,065 (GRCm39) missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 157,722,064 (GRCm39) unclassified probably benign
R1899:Srsf11 UTSW 3 157,737,217 (GRCm39) unclassified probably benign
R2105:Srsf11 UTSW 3 157,724,982 (GRCm39) missense probably damaging 0.99
R4605:Srsf11 UTSW 3 157,728,560 (GRCm39) nonsense probably null
R4655:Srsf11 UTSW 3 157,728,972 (GRCm39) missense probably benign 0.15
R4737:Srsf11 UTSW 3 157,732,369 (GRCm39) nonsense probably null
R5244:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5245:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5379:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5401:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5625:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5763:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5814:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5938:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5944:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R5945:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6126:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6175:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6427:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6435:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6436:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6614:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R6616:Srsf11 UTSW 3 157,728,981 (GRCm39) unclassified probably benign
R8787:Srsf11 UTSW 3 157,718,037 (GRCm39) missense unknown
R9352:Srsf11 UTSW 3 157,717,836 (GRCm39) missense unknown
R9547:Srsf11 UTSW 3 157,717,735 (GRCm39) missense unknown
X0017:Srsf11 UTSW 3 157,721,986 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCATCCTCAAGCCATGTTTC -3'
(R):5'- TTGTGAGGTCTAGAAGATAACTGGG -3'

Sequencing Primer
(F):5'- CCTCAATTCTGTAACAAAGAAGCCTG -3'
(R):5'- GCTAAATGATGATCGCAGCTGAC -3'
Posted On 2019-10-24