Mutagenetix > Incidental Mutations

Incidental Mutation 'R7615:Sh2b2'

588831

Institutional Source

Beutler Lab

Gene Symbol

Sh2b2

Ensembl Gene

ENSMUSG00000005057

Gene Name

SH2B adaptor protein 2

Synonyms

Aps

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R7615 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136218147-136246556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136219657 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 510 (Q510K)

Ref Sequence

ENSEMBL: ENSMUSP00000005188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196397] [ENSMUST00000196447]

PDB Structure

Solution Structure of the Pleckstrin Homology Domain of Mouse APS [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005188
AA Change: Q510K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: Q510K

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
Pfam:Phe_ZIP	17	73	9.3e-22	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000196397
AA Change: Q510K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: Q510K

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	1.5e-30	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196447

SMART Domains

Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	9.1e-28	PFAM
Blast:PH	95	168	9e-22	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	2.2e-11	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	T	C	7: 43,497,849	I320V	possibly damaging	Het
Adat2	A	G	10: 13,553,276	K4R	probably benign	Het
Adgb	G	A	10: 10,436,010	L226F	probably damaging	Het
Adgrb3	C	T	1: 25,098,897	V1192I	probably damaging	Het
Ahsa2	T	A	11: 23,496,750	N71I	possibly damaging	Het
Amigo2	T	G	15: 97,245,342	T400P	probably damaging	Het
Ankhd1	A	T	18: 36,656,773	Q466L		Het
Auh	T	C	13: 52,919,013	I111V	probably benign	Het
Brwd1	A	G	16: 96,033,839	F942L	probably damaging	Het
C1qtnf7	A	G	5: 43,616,144	N262D	probably damaging	Het
Cdh9	T	A	15: 16,856,230	S785R	probably damaging	Het
Celsr3	A	G	9: 108,837,652	T2046A	possibly damaging	Het
Cep170b	T	C	12: 112,744,665	V1493A	probably damaging	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Chd2	T	A	7: 73,441,642	H1617L	probably damaging	Het
Clnk	T	C	5: 38,706,698	D404G	probably damaging	Het
Col18a1	C	T	10: 77,067,005	G795D	probably damaging	Het
Csf3r	T	A	4: 126,037,656	Y477*	probably null	Het
Ddx58	T	A	4: 40,229,653	I89F	possibly damaging	Het
Dnah17	T	A	11: 118,110,547	K857*	probably null	Het
Dnah2	T	G	11: 69,435,304	I3674L	probably damaging	Het
Dnah6	A	C	6: 73,095,206	I2431S	possibly damaging	Het
Eml6	T	A	11: 29,802,501	I971F	possibly damaging	Het
Fam135b	A	T	15: 71,463,323	I674N	probably damaging	Het
Fancc	T	A	13: 63,317,558		probably null	Het
Gabrb2	A	C	11: 42,626,742	K464Q	probably benign	Het
Gbp4	T	A	5: 105,122,982	D261V	possibly damaging	Het
Gdf3	A	G	6: 122,606,916	V164A	probably benign	Het
Gm19410	A	G	8: 35,796,359	D978G	probably damaging	Het
Gm20730	C	T	6: 43,081,774	G35R	probably null	Het
Gm9733	A	G	3: 15,320,485	V119A	probably damaging	Het
Grin2b	G	A	6: 135,923,364	T173I	probably damaging	Het
Gtf3c3	A	T	1: 54,423,572	V344E	possibly damaging	Het
Hsd3b5	A	G	3: 98,630,104	I32T	probably damaging	Het
Ido1	G	C	8: 24,593,188	L74V	probably damaging	Het
Igkv1-88	T	A	6: 68,862,373	D85V	probably damaging	Het
Il22ra1	A	G	4: 135,737,459	I159V	probably benign	Het
Iqgap1	A	T	7: 80,730,100	F1175Y	probably damaging	Het
Iqgap1	A	G	7: 80,751,346	V531A	probably benign	Het
Itga1	T	A	13: 114,996,922	Q484L	probably null	Het
Itga11	A	T	9: 62,744,018	E281V	probably benign	Het
Kpna3	T	C	14: 61,372,962	N343S	possibly damaging	Het
Larp1b	A	G	3: 41,033,534	K64E	possibly damaging	Het
Larp1b	A	G	3: 41,035,816	N133S	probably benign	Het
Lctl	T	A	9: 64,122,110	L161H	probably damaging	Het
Mlip	A	G	9: 77,230,483	S381P	probably damaging	Het
Mroh9	A	G	1: 163,046,032	I518T	probably benign	Het
Mst1r	A	G	9: 107,920,012	Q1360R	probably benign	Het
Muc5b	T	A	7: 141,864,892	C3858*	probably null	Het
Naip1	A	T	13: 100,425,776	H960Q	probably benign	Het
Narfl	C	T	17: 25,782,129	P452S	probably benign	Het
Neo1	A	T	9: 58,884,503	S1321T	probably benign	Het
Nid2	C	A	14: 19,802,530	T1102K	probably damaging	Het
Nsmaf	C	T	4: 6,408,563	V739M	probably damaging	Het
Olfr1019	T	A	2: 85,841,657	M45L	probably benign	Het
Olfr1167	T	C	2: 88,149,518	Q167R	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,590	I156T	probably damaging	Het
Olfr727	T	G	14: 50,126,989	S137R	probably benign	Het
Olfr97	T	G	17: 37,231,450	K307Q	probably benign	Het
Osbpl9	G	A	4: 109,086,339	P159S	probably damaging	Het
Parpbp	A	G	10: 88,093,637	S450P	probably damaging	Het
Pdgfrb	A	G	18: 61,064,046	T185A	probably benign	Het
Pkd1	T	C	17: 24,593,502	V3803A	probably damaging	Het
Plau	A	T	14: 20,839,466	K200*	probably null	Het
Plce1	A	T	19: 38,524,665	Q136L	probably benign	Het
Plekhd1	C	T	12: 80,722,445	T493I	probably benign	Het
Pofut1	T	C	2: 153,259,418	S31P	unknown	Het
Prlr	T	A	15: 10,325,924	I243N	probably damaging	Het
Ptgis	A	G	2: 167,223,988	L174P	probably damaging	Het
Ralgapb	T	A	2: 158,450,270	I792K	probably damaging	Het
Retreg3	C	T	11: 101,102,980	S136N	probably damaging	Het
Rnf213	C	T	11: 119,467,297	T4291M		Het
Rtn1	A	G	12: 72,304,143	Y431H	probably damaging	Het
Rwdd3	A	G	3: 121,171,604		probably benign	Het
Scyl3	A	T	1: 163,950,338		probably null	Het
Sh2b3	G	A	5: 121,818,700	P333S	probably benign	Het
Slc27a6	A	T	18: 58,609,183	N490Y	probably damaging	Het
Slc45a1	C	T	4: 150,638,545	R294Q	probably benign	Het
Sorl1	A	C	9: 41,977,582	I1974S	possibly damaging	Het
Specc1l	C	A	10: 75,263,286	N857K	probably benign	Het
Speg	T	C	1: 75,429,242	L3030P	probably damaging	Het
Spsb1	A	C	4: 149,906,900	D70E	probably benign	Het
Srsf11	A	G	3: 158,016,425	S270P	unknown	Het
Ssr3	A	C	3: 65,387,792	V100G	probably damaging	Het
Synpo	G	A	18: 60,604,475	T133I	probably damaging	Het
Tas2r120	T	G	6: 132,657,810	V285G	probably benign	Het
Tenm4	T	A	7: 96,845,926	V1187D	probably damaging	Het
Tmed8	C	A	12: 87,181,388		probably null	Het
Tmem51	G	A	4: 142,037,564	T61M	probably damaging	Het
Tonsl	A	T	15: 76,630,607	D1132E	probably benign	Het
Tor1aip1	C	T	1: 156,007,584	V358I	possibly damaging	Het
Txlna	A	T	4: 129,630,319	M415K	probably damaging	Het
Tyms	T	A	5: 30,073,560		probably benign	Het
Uggt2	G	T	14: 119,089,269	L177I	probably benign	Het
Uqcrh	T	C	4: 116,069,879	H74R	probably benign	Het
Wnk1	A	T	6: 119,932,738	S33T	probably benign	Het
Zfp553	T	A	7: 127,236,016	C248S	probably damaging	Het
Zfp574	G	A	7: 25,080,576	C341Y	possibly damaging	Het
Zfp729b	T	C	13: 67,591,498	T883A	possibly damaging	Het
Zfp738	T	A	13: 67,670,203	K556N	probably damaging	Het

Other mutations in Sh2b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sh2b2	APN	5	136224419	missense	probably damaging	1.00
IGL01456:Sh2b2	APN	5	136224467	missense	probably damaging	0.98
IGL01612:Sh2b2	APN	5	136231802	missense	probably benign	0.02
IGL02798:Sh2b2	APN	5	136221963	missense	probably damaging	1.00
BB002:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
BB012:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R0492:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R0539:Sh2b2	UTSW	5	136225301	splice site	probably benign
R0707:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R1569:Sh2b2	UTSW	5	136231735	missense	possibly damaging	0.89
R1777:Sh2b2	UTSW	5	136227422	missense	probably damaging	1.00
R2088:Sh2b2	UTSW	5	136232114	missense	possibly damaging	0.87
R3702:Sh2b2	UTSW	5	136224233	missense	probably damaging	0.99
R4223:Sh2b2	UTSW	5	136219053	missense	possibly damaging	0.91
R4597:Sh2b2	UTSW	5	136231762	missense	probably damaging	0.99
R4683:Sh2b2	UTSW	5	136231720	missense	probably damaging	1.00
R4766:Sh2b2	UTSW	5	136231957	missense	probably damaging	0.99
R5486:Sh2b2	UTSW	5	136232090	missense	probably benign	0.10
R6060:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R6322:Sh2b2	UTSW	5	136224188	missense	probably damaging	0.99
R7020:Sh2b2	UTSW	5	136224299	missense	possibly damaging	0.69
R7034:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7036:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7715:Sh2b2	UTSW	5	136219035	missense	probably benign	0.09
R7925:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R8244:Sh2b2	UTSW	5	136227437	nonsense	probably null
R8291:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- TCTAACCTTACAGGGCTTACGG -3'
(R):5'- ACTGACCACTCCCATCTGTG -3'

Sequencing Primer
(F):5'- TTACAGGGCTTACGGAATCC -3'
(R):5'- ACTCCCATCTGTGCCCAC -3'

Posted On

2019-10-24