Incidental Mutation 'R7615:Dnah6'
ID 588834
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72994589-73198634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73072189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 2431 (I2431S)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000064948
AA Change: I2431S

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: I2431S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: I2379S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: I2379S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204053
AA Change: I2431S

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: I2431S

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73,172,720 (GRCm39) missense probably benign 0.00
IGL00488:Dnah6 APN 6 73,063,190 (GRCm39) missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73,172,744 (GRCm39) missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73,189,417 (GRCm39) critical splice donor site probably null
IGL00756:Dnah6 APN 6 73,100,754 (GRCm39) missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73,172,603 (GRCm39) missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73,133,333 (GRCm39) missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73,010,509 (GRCm39) splice site probably benign
IGL00972:Dnah6 APN 6 73,060,140 (GRCm39) splice site probably benign
IGL00975:Dnah6 APN 6 73,150,373 (GRCm39) missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73,051,764 (GRCm39) splice site probably benign
IGL01307:Dnah6 APN 6 73,042,708 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73,150,439 (GRCm39) missense probably benign 0.01
IGL01362:Dnah6 APN 6 73,069,161 (GRCm39) missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73,051,731 (GRCm39) missense probably benign 0.10
IGL01559:Dnah6 APN 6 73,001,235 (GRCm39) critical splice donor site probably null
IGL01622:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73,121,701 (GRCm39) missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73,052,785 (GRCm39) missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73,053,643 (GRCm39) nonsense probably null
IGL01736:Dnah6 APN 6 73,165,360 (GRCm39) missense probably benign 0.06
IGL01825:Dnah6 APN 6 73,042,759 (GRCm39) missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73,112,784 (GRCm39) missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73,009,552 (GRCm39) missense probably benign 0.04
IGL01935:Dnah6 APN 6 73,037,126 (GRCm39) missense probably benign
IGL02126:Dnah6 APN 6 73,080,149 (GRCm39) missense probably benign 0.01
IGL02191:Dnah6 APN 6 72,994,780 (GRCm39) missense probably benign 0.00
IGL02293:Dnah6 APN 6 73,110,633 (GRCm39) splice site probably benign
IGL02316:Dnah6 APN 6 73,145,894 (GRCm39) missense probably benign 0.19
IGL02339:Dnah6 APN 6 73,078,881 (GRCm39) missense probably benign 0.00
IGL02380:Dnah6 APN 6 73,053,623 (GRCm39) missense probably benign 0.12
IGL02458:Dnah6 APN 6 73,004,431 (GRCm39) missense probably benign 0.43
IGL02499:Dnah6 APN 6 72,998,210 (GRCm39) missense probably benign 0.12
IGL02652:Dnah6 APN 6 73,072,087 (GRCm39) missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73,098,806 (GRCm39) missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73,185,582 (GRCm39) missense probably benign 0.03
IGL02875:Dnah6 APN 6 73,115,698 (GRCm39) missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73,009,570 (GRCm39) missense probably benign 0.01
IGL02989:Dnah6 APN 6 73,046,403 (GRCm39) missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73,126,123 (GRCm39) missense probably benign 0.19
IGL03135:Dnah6 APN 6 73,121,987 (GRCm39) missense probably benign 0.00
IGL03145:Dnah6 APN 6 73,018,037 (GRCm39) missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73,121,683 (GRCm39) missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73,030,630 (GRCm39) splice site probably benign
IGL03286:Dnah6 APN 6 73,060,068 (GRCm39) missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73,052,833 (GRCm39) missense probably benign 0.15
P0025:Dnah6 UTSW 6 73,140,487 (GRCm39) missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73,042,738 (GRCm39) missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73,185,624 (GRCm39) missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73,078,863 (GRCm39) missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73,091,565 (GRCm39) missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73,037,243 (GRCm39) missense probably benign 0.02
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73,069,155 (GRCm39) missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73,132,262 (GRCm39) missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73,015,717 (GRCm39) splice site probably benign
R0164:Dnah6 UTSW 6 73,165,518 (GRCm39) splice site probably benign
R0165:Dnah6 UTSW 6 72,998,306 (GRCm39) missense probably benign 0.01
R0183:Dnah6 UTSW 6 73,059,906 (GRCm39) missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73,046,403 (GRCm39) missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73,136,098 (GRCm39) missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73,150,541 (GRCm39) missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73,046,382 (GRCm39) splice site probably benign
R0345:Dnah6 UTSW 6 72,998,240 (GRCm39) missense probably benign 0.12
R0357:Dnah6 UTSW 6 73,165,342 (GRCm39) missense probably benign
R0362:Dnah6 UTSW 6 73,185,592 (GRCm39) missense probably benign 0.06
R0377:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73,060,107 (GRCm39) missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73,021,757 (GRCm39) missense probably benign 0.15
R0639:Dnah6 UTSW 6 72,999,395 (GRCm39) missense probably benign 0.02
R0673:Dnah6 UTSW 6 73,100,794 (GRCm39) missense probably benign 0.01
R0690:Dnah6 UTSW 6 73,106,457 (GRCm39) missense probably benign 0.01
R0708:Dnah6 UTSW 6 73,189,605 (GRCm39) missense probably benign 0.05
R0711:Dnah6 UTSW 6 73,064,585 (GRCm39) missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73,012,276 (GRCm39) missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73,101,740 (GRCm39) missense probably benign 0.00
R0972:Dnah6 UTSW 6 73,136,176 (GRCm39) missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73,121,948 (GRCm39) missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73,136,118 (GRCm39) missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73,101,692 (GRCm39) missense probably benign 0.22
R1301:Dnah6 UTSW 6 73,185,528 (GRCm39) critical splice donor site probably null
R1341:Dnah6 UTSW 6 73,168,602 (GRCm39) missense probably benign 0.09
R1509:Dnah6 UTSW 6 73,004,425 (GRCm39) missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73,026,031 (GRCm39) missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73,128,536 (GRCm39) missense probably benign
R1557:Dnah6 UTSW 6 73,026,114 (GRCm39) nonsense probably null
R1591:Dnah6 UTSW 6 73,053,583 (GRCm39) missense probably benign 0.01
R1602:Dnah6 UTSW 6 73,044,452 (GRCm39) missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73,121,946 (GRCm39) missense probably benign 0.09
R1616:Dnah6 UTSW 6 73,077,095 (GRCm39) missense probably benign 0.10
R1643:Dnah6 UTSW 6 73,021,735 (GRCm39) missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73,132,279 (GRCm39) missense probably benign 0.18
R1655:Dnah6 UTSW 6 73,182,715 (GRCm39) missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1665:Dnah6 UTSW 6 73,101,761 (GRCm39) missense probably benign 0.00
R1675:Dnah6 UTSW 6 73,106,523 (GRCm39) missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73,021,744 (GRCm39) missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73,137,965 (GRCm39) missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73,001,941 (GRCm39) missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73,158,780 (GRCm39) missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73,077,071 (GRCm39) missense probably benign 0.00
R1897:Dnah6 UTSW 6 73,158,745 (GRCm39) missense probably benign 0.30
R1951:Dnah6 UTSW 6 73,061,704 (GRCm39) nonsense probably null
R1978:Dnah6 UTSW 6 73,098,953 (GRCm39) missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73,072,027 (GRCm39) missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73,069,175 (GRCm39) missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73,044,449 (GRCm39) missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73,150,402 (GRCm39) missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73,004,405 (GRCm39) missense probably benign
R2041:Dnah6 UTSW 6 73,050,422 (GRCm39) missense probably damaging 1.00
R2068:Dnah6 UTSW 6 72,998,165 (GRCm39) missense probably benign 0.23
R2114:Dnah6 UTSW 6 73,121,018 (GRCm39) missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73,026,149 (GRCm39) missense probably benign 0.32
R2163:Dnah6 UTSW 6 73,066,729 (GRCm39) splice site probably null
R2193:Dnah6 UTSW 6 73,115,623 (GRCm39) missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73,077,068 (GRCm39) missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73,090,564 (GRCm39) missense probably benign 0.15
R2292:Dnah6 UTSW 6 72,998,092 (GRCm39) missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73,133,404 (GRCm39) missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73,068,950 (GRCm39) splice site probably null
R2436:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.05
R2847:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R2848:Dnah6 UTSW 6 73,106,314 (GRCm39) missense probably benign 0.41
R3033:Dnah6 UTSW 6 73,150,333 (GRCm39) missense probably benign 0.03
R3429:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73,098,797 (GRCm39) missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73,009,616 (GRCm39) missense probably benign 0.21
R3811:Dnah6 UTSW 6 73,168,481 (GRCm39) missense probably benign 0.00
R3852:Dnah6 UTSW 6 73,104,910 (GRCm39) missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73,098,975 (GRCm39) missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73,066,575 (GRCm39) nonsense probably null
R4246:Dnah6 UTSW 6 73,106,431 (GRCm39) missense probably benign 0.00
R4367:Dnah6 UTSW 6 73,126,467 (GRCm39) missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73,095,009 (GRCm39) missense probably benign 0.01
R4405:Dnah6 UTSW 6 73,106,274 (GRCm39) missense probably benign 0.00
R4420:Dnah6 UTSW 6 73,168,462 (GRCm39) missense probably benign
R4486:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73,155,399 (GRCm39) missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73,169,388 (GRCm39) missense probably benign
R4573:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73,063,164 (GRCm39) missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73,129,695 (GRCm39) missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73,106,643 (GRCm39) missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73,047,580 (GRCm39) missense probably benign
R4653:Dnah6 UTSW 6 73,050,440 (GRCm39) missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73,014,671 (GRCm39) missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73,169,405 (GRCm39) missense probably benign 0.04
R4712:Dnah6 UTSW 6 73,001,995 (GRCm39) critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73,106,513 (GRCm39) missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73,072,057 (GRCm39) missense probably benign 0.11
R4792:Dnah6 UTSW 6 73,066,651 (GRCm39) missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73,066,681 (GRCm39) missense probably damaging 1.00
R4817:Dnah6 UTSW 6 72,999,407 (GRCm39) missense probably benign 0.02
R4830:Dnah6 UTSW 6 73,021,745 (GRCm39) missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73,098,771 (GRCm39) missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73,169,659 (GRCm39) intron probably benign
R4948:Dnah6 UTSW 6 73,030,672 (GRCm39) missense probably benign 0.00
R4953:Dnah6 UTSW 6 73,165,366 (GRCm39) missense probably benign 0.19
R5000:Dnah6 UTSW 6 73,121,798 (GRCm39) missense probably benign 0.26
R5036:Dnah6 UTSW 6 73,021,674 (GRCm39) missense probably benign
R5044:Dnah6 UTSW 6 73,014,605 (GRCm39) missense probably benign 0.41
R5143:Dnah6 UTSW 6 73,158,744 (GRCm39) missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73,172,617 (GRCm39) missense probably benign
R5186:Dnah6 UTSW 6 73,044,410 (GRCm39) missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73,172,715 (GRCm39) missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73,090,471 (GRCm39) missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73,104,844 (GRCm39) critical splice donor site probably null
R5330:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73,051,573 (GRCm39) missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73,189,603 (GRCm39) missense probably benign
R5343:Dnah6 UTSW 6 73,189,599 (GRCm39) missense probably benign
R5375:Dnah6 UTSW 6 73,100,838 (GRCm39) missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73,014,598 (GRCm39) missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73,037,121 (GRCm39) missense probably benign 0.00
R5455:Dnah6 UTSW 6 73,052,717 (GRCm39) missense probably benign 0.00
R5458:Dnah6 UTSW 6 73,063,168 (GRCm39) missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73,069,140 (GRCm39) missense probably benign 0.04
R5484:Dnah6 UTSW 6 73,069,099 (GRCm39) missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73,167,402 (GRCm39) missense probably null 0.00
R5527:Dnah6 UTSW 6 73,136,212 (GRCm39) missense probably benign
R5541:Dnah6 UTSW 6 73,169,971 (GRCm39) missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73,128,672 (GRCm39) missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73,126,508 (GRCm39) missense probably damaging 1.00
R5689:Dnah6 UTSW 6 72,998,210 (GRCm39) missense probably benign 0.12
R5966:Dnah6 UTSW 6 73,037,262 (GRCm39) missense probably benign 0.00
R5980:Dnah6 UTSW 6 73,158,705 (GRCm39) missense probably benign 0.01
R6049:Dnah6 UTSW 6 73,063,149 (GRCm39) missense probably benign 0.38
R6092:Dnah6 UTSW 6 73,091,680 (GRCm39) missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73,165,477 (GRCm39) missense probably benign 0.16
R6279:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73,042,798 (GRCm39) missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73,063,200 (GRCm39) missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73,168,588 (GRCm39) missense probably benign 0.02
R6394:Dnah6 UTSW 6 73,132,401 (GRCm39) nonsense probably null
R6470:Dnah6 UTSW 6 73,051,569 (GRCm39) missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73,051,687 (GRCm39) missense probably benign 0.05
R6545:Dnah6 UTSW 6 73,021,715 (GRCm39) missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73,150,516 (GRCm39) missense probably benign 0.02
R6609:Dnah6 UTSW 6 73,030,678 (GRCm39) missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73,012,263 (GRCm39) splice site probably null
R6640:Dnah6 UTSW 6 73,001,276 (GRCm39) missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73,115,743 (GRCm39) missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73,014,532 (GRCm39) missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73,110,591 (GRCm39) missense probably benign 0.29
R6845:Dnah6 UTSW 6 73,110,525 (GRCm39) missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73,189,505 (GRCm39) missense probably benign 0.00
R6918:Dnah6 UTSW 6 73,158,738 (GRCm39) nonsense probably null
R6929:Dnah6 UTSW 6 73,021,756 (GRCm39) missense probably damaging 0.96
R6981:Dnah6 UTSW 6 72,998,161 (GRCm39) missense probably benign 0.00
R7065:Dnah6 UTSW 6 73,064,545 (GRCm39) missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73,112,663 (GRCm39) missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73,015,729 (GRCm39) missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73,158,688 (GRCm39) critical splice donor site probably null
R7203:Dnah6 UTSW 6 73,150,528 (GRCm39) missense probably benign 0.00
R7315:Dnah6 UTSW 6 73,061,743 (GRCm39) missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73,121,705 (GRCm39) nonsense probably null
R7387:Dnah6 UTSW 6 73,189,595 (GRCm39) nonsense probably null
R7388:Dnah6 UTSW 6 73,169,300 (GRCm39) missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73,189,475 (GRCm39) missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73,104,887 (GRCm39) missense probably benign 0.04
R7524:Dnah6 UTSW 6 73,095,082 (GRCm39) missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73,004,423 (GRCm39) missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73,126,413 (GRCm39) missense probably benign 0.01
R7604:Dnah6 UTSW 6 73,069,151 (GRCm39) missense probably damaging 1.00
R7622:Dnah6 UTSW 6 73,101,742 (GRCm39) missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73,146,063 (GRCm39) splice site probably null
R7735:Dnah6 UTSW 6 73,046,412 (GRCm39) missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73,002,703 (GRCm39) missense probably benign 0.41
R7829:Dnah6 UTSW 6 73,104,902 (GRCm39) nonsense probably null
R7904:Dnah6 UTSW 6 73,112,450 (GRCm39) splice site probably null
R8034:Dnah6 UTSW 6 73,106,208 (GRCm39) missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73,137,896 (GRCm39) missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73,002,769 (GRCm39) missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73,037,208 (GRCm39) missense probably benign 0.16
R8206:Dnah6 UTSW 6 73,014,549 (GRCm39) nonsense probably null
R8214:Dnah6 UTSW 6 73,021,711 (GRCm39) missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73,145,810 (GRCm39) critical splice donor site probably null
R8273:Dnah6 UTSW 6 73,172,664 (GRCm39) missense probably benign 0.00
R8273:Dnah6 UTSW 6 73,053,582 (GRCm39) missense probably benign 0.31
R8331:Dnah6 UTSW 6 73,001,983 (GRCm39) missense probably benign 0.10
R8350:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8428:Dnah6 UTSW 6 73,051,634 (GRCm39) missense probably benign 0.15
R8447:Dnah6 UTSW 6 73,115,757 (GRCm39) missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73,172,798 (GRCm39) missense probably benign 0.41
R8517:Dnah6 UTSW 6 73,155,440 (GRCm39) missense probably benign 0.16
R8523:Dnah6 UTSW 6 73,072,171 (GRCm39) missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73,145,850 (GRCm39) missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73,052,873 (GRCm39) intron probably benign
R8737:Dnah6 UTSW 6 73,044,428 (GRCm39) missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73,156,811 (GRCm39) missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73,042,756 (GRCm39) missense probably benign
R8809:Dnah6 UTSW 6 73,009,546 (GRCm39) missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73,104,937 (GRCm39) missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73,121,156 (GRCm39) critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 72,998,131 (GRCm39) missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73,155,481 (GRCm39) missense probably benign 0.05
R8973:Dnah6 UTSW 6 73,121,734 (GRCm39) missense probably benign 0.39
R9049:Dnah6 UTSW 6 73,119,275 (GRCm39) missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73,061,640 (GRCm39) missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73,126,156 (GRCm39) missense probably benign 0.00
R9077:Dnah6 UTSW 6 73,121,029 (GRCm39) nonsense probably null
R9102:Dnah6 UTSW 6 73,044,469 (GRCm39) missense probably benign
R9106:Dnah6 UTSW 6 73,121,752 (GRCm39) missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73,037,186 (GRCm39) missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73,098,882 (GRCm39) missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73,121,924 (GRCm39) missense probably damaging 1.00
R9182:Dnah6 UTSW 6 73,121,688 (GRCm39) nonsense probably null
R9200:Dnah6 UTSW 6 73,004,497 (GRCm39) missense probably benign 0.06
R9265:Dnah6 UTSW 6 73,060,040 (GRCm39) missense probably benign 0.02
R9368:Dnah6 UTSW 6 72,998,261 (GRCm39) missense probably benign 0.22
R9378:Dnah6 UTSW 6 73,189,513 (GRCm39) missense probably benign
R9439:Dnah6 UTSW 6 73,012,330 (GRCm39) missense possibly damaging 0.66
R9506:Dnah6 UTSW 6 73,119,299 (GRCm39) missense probably damaging 1.00
R9645:Dnah6 UTSW 6 73,115,750 (GRCm39) missense possibly damaging 0.82
R9731:Dnah6 UTSW 6 73,168,589 (GRCm39) missense probably benign 0.00
RF002:Dnah6 UTSW 6 73,078,872 (GRCm39) missense probably benign
RF020:Dnah6 UTSW 6 73,095,040 (GRCm39) missense probably benign 0.00
W0251:Dnah6 UTSW 6 73,155,501 (GRCm39) missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73,168,483 (GRCm39) missense probably benign 0.01
X0025:Dnah6 UTSW 6 73,014,656 (GRCm39) missense probably damaging 1.00
Z1176:Dnah6 UTSW 6 73,110,542 (GRCm39) missense probably benign
Z1176:Dnah6 UTSW 6 73,064,766 (GRCm39) missense possibly damaging 0.79
Z1177:Dnah6 UTSW 6 73,009,509 (GRCm39) missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 72,998,220 (GRCm39) missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73,132,255 (GRCm39) missense possibly damaging 0.92
Z1177:Dnah6 UTSW 6 73,018,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACTGTTTATGTACCTGGG -3'
(R):5'- CCAGCCATGATTTGCCTGAG -3'

Sequencing Primer
(F):5'- ACCTGGGTGTCTGTGAAAAG -3'
(R):5'- CAGCCATGATTTGCCTGAGATAGAC -3'
Posted On 2019-10-24