Mutagenetix > Incidental Mutations

Incidental Mutation 'R7615:Grin2b'

588838

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7615 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135923364 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 173 (T173I)

Ref Sequence

ENSEMBL: ENSMUSP00000142696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: T173I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: T173I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: T173I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: T173I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152012
AA Change: T173I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: T173I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	T	C	7: 43,497,849	I320V	possibly damaging	Het
Adat2	A	G	10: 13,553,276	K4R	probably benign	Het
Adgb	G	A	10: 10,436,010	L226F	probably damaging	Het
Adgrb3	C	T	1: 25,098,897	V1192I	probably damaging	Het
Ahsa2	T	A	11: 23,496,750	N71I	possibly damaging	Het
Amigo2	T	G	15: 97,245,342	T400P	probably damaging	Het
Ankhd1	A	T	18: 36,656,773	Q466L		Het
Auh	T	C	13: 52,919,013	I111V	probably benign	Het
Brwd1	A	G	16: 96,033,839	F942L	probably damaging	Het
C1qtnf7	A	G	5: 43,616,144	N262D	probably damaging	Het
Cdh9	T	A	15: 16,856,230	S785R	probably damaging	Het
Celsr3	A	G	9: 108,837,652	T2046A	possibly damaging	Het
Cep170b	T	C	12: 112,744,665	V1493A	probably damaging	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Chd2	T	A	7: 73,441,642	H1617L	probably damaging	Het
Clnk	T	C	5: 38,706,698	D404G	probably damaging	Het
Col18a1	C	T	10: 77,067,005	G795D	probably damaging	Het
Csf3r	T	A	4: 126,037,656	Y477*	probably null	Het
Ddx58	T	A	4: 40,229,653	I89F	possibly damaging	Het
Dnah17	T	A	11: 118,110,547	K857*	probably null	Het
Dnah2	T	G	11: 69,435,304	I3674L	probably damaging	Het
Dnah6	A	C	6: 73,095,206	I2431S	possibly damaging	Het
Eml6	T	A	11: 29,802,501	I971F	possibly damaging	Het
Fam135b	A	T	15: 71,463,323	I674N	probably damaging	Het
Fancc	T	A	13: 63,317,558		probably null	Het
Gabrb2	A	C	11: 42,626,742	K464Q	probably benign	Het
Gbp4	T	A	5: 105,122,982	D261V	possibly damaging	Het
Gdf3	A	G	6: 122,606,916	V164A	probably benign	Het
Gm19410	A	G	8: 35,796,359	D978G	probably damaging	Het
Gm20730	C	T	6: 43,081,774	G35R	probably null	Het
Gm9733	A	G	3: 15,320,485	V119A	probably damaging	Het
Gtf3c3	A	T	1: 54,423,572	V344E	possibly damaging	Het
Hsd3b5	A	G	3: 98,630,104	I32T	probably damaging	Het
Ido1	G	C	8: 24,593,188	L74V	probably damaging	Het
Igkv1-88	T	A	6: 68,862,373	D85V	probably damaging	Het
Il22ra1	A	G	4: 135,737,459	I159V	probably benign	Het
Iqgap1	A	T	7: 80,730,100	F1175Y	probably damaging	Het
Iqgap1	A	G	7: 80,751,346	V531A	probably benign	Het
Itga1	T	A	13: 114,996,922	Q484L	probably null	Het
Itga11	A	T	9: 62,744,018	E281V	probably benign	Het
Kpna3	T	C	14: 61,372,962	N343S	possibly damaging	Het
Larp1b	A	G	3: 41,033,534	K64E	possibly damaging	Het
Larp1b	A	G	3: 41,035,816	N133S	probably benign	Het
Lctl	T	A	9: 64,122,110	L161H	probably damaging	Het
Mlip	A	G	9: 77,230,483	S381P	probably damaging	Het
Mroh9	A	G	1: 163,046,032	I518T	probably benign	Het
Mst1r	A	G	9: 107,920,012	Q1360R	probably benign	Het
Muc5b	T	A	7: 141,864,892	C3858*	probably null	Het
Naip1	A	T	13: 100,425,776	H960Q	probably benign	Het
Narfl	C	T	17: 25,782,129	P452S	probably benign	Het
Neo1	A	T	9: 58,884,503	S1321T	probably benign	Het
Nid2	C	A	14: 19,802,530	T1102K	probably damaging	Het
Nsmaf	C	T	4: 6,408,563	V739M	probably damaging	Het
Olfr1019	T	A	2: 85,841,657	M45L	probably benign	Het
Olfr1167	T	C	2: 88,149,518	Q167R	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,590	I156T	probably damaging	Het
Olfr727	T	G	14: 50,126,989	S137R	probably benign	Het
Olfr97	T	G	17: 37,231,450	K307Q	probably benign	Het
Osbpl9	G	A	4: 109,086,339	P159S	probably damaging	Het
Parpbp	A	G	10: 88,093,637	S450P	probably damaging	Het
Pdgfrb	A	G	18: 61,064,046	T185A	probably benign	Het
Pkd1	T	C	17: 24,593,502	V3803A	probably damaging	Het
Plau	A	T	14: 20,839,466	K200*	probably null	Het
Plce1	A	T	19: 38,524,665	Q136L	probably benign	Het
Plekhd1	C	T	12: 80,722,445	T493I	probably benign	Het
Pofut1	T	C	2: 153,259,418	S31P	unknown	Het
Prlr	T	A	15: 10,325,924	I243N	probably damaging	Het
Ptgis	A	G	2: 167,223,988	L174P	probably damaging	Het
Ralgapb	T	A	2: 158,450,270	I792K	probably damaging	Het
Retreg3	C	T	11: 101,102,980	S136N	probably damaging	Het
Rnf213	C	T	11: 119,467,297	T4291M		Het
Rtn1	A	G	12: 72,304,143	Y431H	probably damaging	Het
Rwdd3	A	G	3: 121,171,604		probably benign	Het
Scyl3	A	T	1: 163,950,338		probably null	Het
Sh2b2	G	T	5: 136,219,657	Q510K	probably damaging	Het
Sh2b3	G	A	5: 121,818,700	P333S	probably benign	Het
Slc27a6	A	T	18: 58,609,183	N490Y	probably damaging	Het
Slc45a1	C	T	4: 150,638,545	R294Q	probably benign	Het
Sorl1	A	C	9: 41,977,582	I1974S	possibly damaging	Het
Specc1l	C	A	10: 75,263,286	N857K	probably benign	Het
Speg	T	C	1: 75,429,242	L3030P	probably damaging	Het
Spsb1	A	C	4: 149,906,900	D70E	probably benign	Het
Srsf11	A	G	3: 158,016,425	S270P	unknown	Het
Ssr3	A	C	3: 65,387,792	V100G	probably damaging	Het
Synpo	G	A	18: 60,604,475	T133I	probably damaging	Het
Tas2r120	T	G	6: 132,657,810	V285G	probably benign	Het
Tenm4	T	A	7: 96,845,926	V1187D	probably damaging	Het
Tmed8	C	A	12: 87,181,388		probably null	Het
Tmem51	G	A	4: 142,037,564	T61M	probably damaging	Het
Tonsl	A	T	15: 76,630,607	D1132E	probably benign	Het
Tor1aip1	C	T	1: 156,007,584	V358I	possibly damaging	Het
Txlna	A	T	4: 129,630,319	M415K	probably damaging	Het
Tyms	T	A	5: 30,073,560		probably benign	Het
Uggt2	G	T	14: 119,089,269	L177I	probably benign	Het
Uqcrh	T	C	4: 116,069,879	H74R	probably benign	Het
Wnk1	A	T	6: 119,932,738	S33T	probably benign	Het
Zfp553	T	A	7: 127,236,016	C248S	probably damaging	Het
Zfp574	G	A	7: 25,080,576	C341Y	possibly damaging	Het
Zfp729b	T	C	13: 67,591,498	T883A	possibly damaging	Het
Zfp738	T	A	13: 67,670,203	K556N	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACTTCGAAGATGTAGGTGGC -3'
(R):5'- GCATCCACTTGATTCACAATCC -3'

Sequencing Primer
(F):5'- CCTTTGTGCAGTAGAGGAGAATG -3'
(R):5'- ACAATCCCTGTGGCTATCTGTTTG -3'

Posted On

2019-10-24