Incidental Mutation 'R7615:4931406B18Rik'
ID 588840
Institutional Source Beutler Lab
Gene Symbol 4931406B18Rik
Ensembl Gene ENSMUSG00000013353
Gene Name RIKEN cDNA 4931406B18 gene
Synonyms
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43141468-43155364 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43147273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 320 (I320V)
Ref Sequence ENSEMBL: ENSMUSP00000013497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013497] [ENSMUST00000163474] [ENSMUST00000163619] [ENSMUST00000168213] [ENSMUST00000168883] [ENSMUST00000171174] [ENSMUST00000191516]
AlphaFold A2RSL7
Predicted Effect possibly damaging
Transcript: ENSMUST00000013497
AA Change: I320V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013497
Gene: ENSMUSG00000013353
AA Change: I320V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2ZG3|A 24 185 9e-7 PDB
Blast:IG_like 119 185 3e-19 BLAST
low complexity region 186 205 N/A INTRINSIC
SCOP:d1iray3 219 297 6e-3 SMART
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163474
AA Change: I226V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126619
Gene: ENSMUSG00000013353
AA Change: I226V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 111 3e-12 BLAST
SCOP:d1he7a_ 111 203 1e-3 SMART
Blast:IG_like 125 194 1e-5 BLAST
transmembrane domain 217 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163619
SMART Domains Protein: ENSMUSP00000131071
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:2ZG3|A 17 88 1e-5 PDB
Blast:IG_like 22 88 2e-21 BLAST
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168213
SMART Domains Protein: ENSMUSP00000129928
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 119 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168883
Predicted Effect possibly damaging
Transcript: ENSMUST00000171174
AA Change: I320V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129888
Gene: ENSMUSG00000013353
AA Change: I320V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191516
AA Change: I320V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139468
Gene: ENSMUSG00000013353
AA Change: I320V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Celsr3 A G 9: 108,714,851 (GRCm39) T2046A possibly damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in 4931406B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:4931406B18Rik APN 7 43,153,599 (GRCm39) splice site probably benign
IGL01902:4931406B18Rik APN 7 43,147,267 (GRCm39) missense probably damaging 0.96
IGL02616:4931406B18Rik APN 7 43,150,437 (GRCm39) splice site probably null
IGL02677:4931406B18Rik APN 7 43,150,519 (GRCm39) nonsense probably null
IGL03030:4931406B18Rik APN 7 43,145,057 (GRCm39) missense possibly damaging 0.62
R0007:4931406B18Rik UTSW 7 43,147,466 (GRCm39) splice site probably benign
R0788:4931406B18Rik UTSW 7 43,148,623 (GRCm39) missense probably damaging 0.98
R1544:4931406B18Rik UTSW 7 43,147,543 (GRCm39) missense possibly damaging 0.92
R2995:4931406B18Rik UTSW 7 43,148,792 (GRCm39) missense probably damaging 1.00
R4656:4931406B18Rik UTSW 7 43,150,565 (GRCm39) missense probably benign 0.20
R5595:4931406B18Rik UTSW 7 43,147,296 (GRCm39) missense possibly damaging 0.92
R6288:4931406B18Rik UTSW 7 43,147,549 (GRCm39) missense probably damaging 1.00
R6389:4931406B18Rik UTSW 7 43,147,254 (GRCm39) missense possibly damaging 0.94
R6651:4931406B18Rik UTSW 7 43,147,496 (GRCm39) missense possibly damaging 0.81
R6912:4931406B18Rik UTSW 7 43,150,571 (GRCm39) missense possibly damaging 0.95
R7254:4931406B18Rik UTSW 7 43,147,623 (GRCm39) missense probably damaging 0.99
R8167:4931406B18Rik UTSW 7 43,147,288 (GRCm39) missense possibly damaging 0.79
R9052:4931406B18Rik UTSW 7 43,147,631 (GRCm39) nonsense probably null
R9109:4931406B18Rik UTSW 7 43,148,702 (GRCm39) missense
R9182:4931406B18Rik UTSW 7 43,153,640 (GRCm39) missense probably damaging 0.97
R9201:4931406B18Rik UTSW 7 43,150,709 (GRCm39) missense possibly damaging 0.46
R9787:4931406B18Rik UTSW 7 43,150,695 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAGGAGCCTTCAGTCAAGAC -3'
(R):5'- TCTTCTTGATACCAGGTGAATGGAG -3'

Sequencing Primer
(F):5'- CTATGAAGGGCACATGCATTTGC -3'
(R):5'- AGAGAGGCCCTGTGTGACTG -3'
Posted On 2019-10-24