Incidental Mutation 'R7615:Mst1r'
ID588854
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R7615 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107920012 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1360 (Q1360R)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect probably benign
Transcript: ENSMUST00000035203
AA Change: Q1360R

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: Q1360R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Adgrb3 C T 1: 25,098,897 V1192I probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Ankhd1 A T 18: 36,656,773 Q466L Het
Auh T C 13: 52,919,013 I111V probably benign Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Scyl3 A T 1: 163,950,338 probably null Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Sh2b3 G A 5: 121,818,700 P333S probably benign Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Synpo G A 18: 60,604,475 T133I probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGTGATGCTTCGATGCTGG -3'
(R):5'- ATGTCACTGGCTCATGCTG -3'

Sequencing Primer
(F):5'- TCGATGCTGGGAGGCTGAC -3'
(R):5'- TCAAATGGGCCCGGTTTC -3'
Posted On2019-10-24