Incidental Mutation 'R7615:Celsr3'
ID 588855
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Name cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms Fmi1, flamingo, Adgrc3
MMRRC Submission 045683-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108703519-108730168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108714851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2046 (T2046A)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000024238
AA Change: T2044A

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: T2044A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213524
AA Change: T2046A

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,147,273 (GRCm39) I320V possibly damaging Het
Adat2 A G 10: 13,429,020 (GRCm39) K4R probably benign Het
Adgb G A 10: 10,311,754 (GRCm39) L226F probably damaging Het
Adgrb3 C T 1: 25,137,978 (GRCm39) V1192I probably damaging Het
Ahsa2 T A 11: 23,446,750 (GRCm39) N71I possibly damaging Het
Amigo2 T G 15: 97,143,223 (GRCm39) T400P probably damaging Het
Ankhd1 A T 18: 36,789,826 (GRCm39) Q466L Het
Auh T C 13: 53,073,049 (GRCm39) I111V probably benign Het
Brwd1 A G 16: 95,835,039 (GRCm39) F942L probably damaging Het
C1qtnf7 A G 5: 43,773,486 (GRCm39) N262D probably damaging Het
Cdh9 T A 15: 16,856,316 (GRCm39) S785R probably damaging Het
Cep170b T C 12: 112,711,099 (GRCm39) V1493A probably damaging Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Chd2 T A 7: 73,091,390 (GRCm39) H1617L probably damaging Het
Ciao3 C T 17: 26,001,103 (GRCm39) P452S probably benign Het
Clnk T C 5: 38,864,041 (GRCm39) D404G probably damaging Het
Col18a1 C T 10: 76,902,839 (GRCm39) G795D probably damaging Het
Csf3r T A 4: 125,931,449 (GRCm39) Y477* probably null Het
Dnah17 T A 11: 118,001,373 (GRCm39) K857* probably null Het
Dnah2 T G 11: 69,326,130 (GRCm39) I3674L probably damaging Het
Dnah6 A C 6: 73,072,189 (GRCm39) I2431S possibly damaging Het
Eml6 T A 11: 29,752,501 (GRCm39) I971F possibly damaging Het
Fam135b A T 15: 71,335,172 (GRCm39) I674N probably damaging Het
Fancc T A 13: 63,465,372 (GRCm39) probably null Het
Gabrb2 A C 11: 42,517,569 (GRCm39) K464Q probably benign Het
Gbp4 T A 5: 105,270,848 (GRCm39) D261V possibly damaging Het
Gdf3 A G 6: 122,583,875 (GRCm39) V164A probably benign Het
Gm19410 A G 8: 36,263,513 (GRCm39) D978G probably damaging Het
Gm20730 C T 6: 43,058,708 (GRCm39) G35R probably null Het
Grin2b G A 6: 135,900,362 (GRCm39) T173I probably damaging Het
Gtf3c3 A T 1: 54,462,731 (GRCm39) V344E possibly damaging Het
Hsd3b5 A G 3: 98,537,420 (GRCm39) I32T probably damaging Het
Ido1 G C 8: 25,083,204 (GRCm39) L74V probably damaging Het
Igkv1-88 T A 6: 68,839,357 (GRCm39) D85V probably damaging Het
Il22ra1 A G 4: 135,464,770 (GRCm39) I159V probably benign Het
Iqgap1 A T 7: 80,379,848 (GRCm39) F1175Y probably damaging Het
Iqgap1 A G 7: 80,401,094 (GRCm39) V531A probably benign Het
Itga1 T A 13: 115,133,458 (GRCm39) Q484L probably null Het
Itga11 A T 9: 62,651,300 (GRCm39) E281V probably benign Het
Kpna3 T C 14: 61,610,411 (GRCm39) N343S possibly damaging Het
Larp1b A G 3: 40,987,969 (GRCm39) K64E possibly damaging Het
Larp1b A G 3: 40,990,251 (GRCm39) N133S probably benign Het
Lctl T A 9: 64,029,392 (GRCm39) L161H probably damaging Het
Mlip A G 9: 77,137,765 (GRCm39) S381P probably damaging Het
Mroh9 A G 1: 162,873,601 (GRCm39) I518T probably benign Het
Mst1r A G 9: 107,797,211 (GRCm39) Q1360R probably benign Het
Muc5b T A 7: 141,418,629 (GRCm39) C3858* probably null Het
Naip1 A T 13: 100,562,284 (GRCm39) H960Q probably benign Het
Neo1 A T 9: 58,791,786 (GRCm39) S1321T probably benign Het
Nid2 C A 14: 19,852,598 (GRCm39) T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 (GRCm39) V739M probably damaging Het
Or1o2 T G 17: 37,542,341 (GRCm39) K307Q probably benign Het
Or4k15 T G 14: 50,364,446 (GRCm39) S137R probably benign Het
Or5ar1 T A 2: 85,672,001 (GRCm39) M45L probably benign Het
Or5b110-ps1 A G 19: 13,259,954 (GRCm39) I156T probably damaging Het
Or5d39 T C 2: 87,979,862 (GRCm39) Q167R probably benign Het
Osbpl9 G A 4: 108,943,536 (GRCm39) P159S probably damaging Het
Parpbp A G 10: 87,929,499 (GRCm39) S450P probably damaging Het
Pdgfrb A G 18: 61,197,118 (GRCm39) T185A probably benign Het
Pkd1 T C 17: 24,812,476 (GRCm39) V3803A probably damaging Het
Plau A T 14: 20,889,534 (GRCm39) K200* probably null Het
Plce1 A T 19: 38,513,109 (GRCm39) Q136L probably benign Het
Plekhd1 C T 12: 80,769,219 (GRCm39) T493I probably benign Het
Pofut1 T C 2: 153,101,338 (GRCm39) S31P unknown Het
Prlr T A 15: 10,326,010 (GRCm39) I243N probably damaging Het
Ptgis A G 2: 167,065,908 (GRCm39) L174P probably damaging Het
Ralgapb T A 2: 158,292,190 (GRCm39) I792K probably damaging Het
Retreg3 C T 11: 100,993,806 (GRCm39) S136N probably damaging Het
Rigi T A 4: 40,229,653 (GRCm39) I89F possibly damaging Het
Rnf213 C T 11: 119,358,123 (GRCm39) T4291M Het
Rtn1 A G 12: 72,350,917 (GRCm39) Y431H probably damaging Het
Rwdd3 A G 3: 120,965,253 (GRCm39) probably benign Het
Scyl3 A T 1: 163,777,907 (GRCm39) probably null Het
Sh2b2 G T 5: 136,248,511 (GRCm39) Q510K probably damaging Het
Sh2b3 G A 5: 121,956,763 (GRCm39) P333S probably benign Het
Sirpd A G 3: 15,385,545 (GRCm39) V119A probably damaging Het
Slc27a6 A T 18: 58,742,255 (GRCm39) N490Y probably damaging Het
Slc45a1 C T 4: 150,723,002 (GRCm39) R294Q probably benign Het
Sorl1 A C 9: 41,888,878 (GRCm39) I1974S possibly damaging Het
Specc1l C A 10: 75,099,120 (GRCm39) N857K probably benign Het
Speg T C 1: 75,405,886 (GRCm39) L3030P probably damaging Het
Spsb1 A C 4: 149,991,357 (GRCm39) D70E probably benign Het
Srsf11 A G 3: 157,722,062 (GRCm39) S270P unknown Het
Ssr3 A C 3: 65,295,213 (GRCm39) V100G probably damaging Het
Synpo G A 18: 60,737,547 (GRCm39) T133I probably damaging Het
Tas2r120 T G 6: 132,634,773 (GRCm39) V285G probably benign Het
Tenm4 T A 7: 96,495,133 (GRCm39) V1187D probably damaging Het
Tmed8 C A 12: 87,228,162 (GRCm39) probably null Het
Tmem51 G A 4: 141,764,875 (GRCm39) T61M probably damaging Het
Tonsl A T 15: 76,514,807 (GRCm39) D1132E probably benign Het
Tor1aip1 C T 1: 155,883,330 (GRCm39) V358I possibly damaging Het
Txlna A T 4: 129,524,112 (GRCm39) M415K probably damaging Het
Tyms T A 5: 30,278,558 (GRCm39) probably benign Het
Uggt2 G T 14: 119,326,681 (GRCm39) L177I probably benign Het
Uqcrh T C 4: 115,927,076 (GRCm39) H74R probably benign Het
Wnk1 A T 6: 119,909,699 (GRCm39) S33T probably benign Het
Zfp553 T A 7: 126,835,188 (GRCm39) C248S probably damaging Het
Zfp574 G A 7: 24,780,001 (GRCm39) C341Y possibly damaging Het
Zfp729b T C 13: 67,739,617 (GRCm39) T883A possibly damaging Het
Zfp738 T A 13: 67,818,322 (GRCm39) K556N probably damaging Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108,726,124 (GRCm39) missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108,706,391 (GRCm39) missense probably benign 0.33
IGL00552:Celsr3 APN 9 108,718,462 (GRCm39) missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108,719,775 (GRCm39) missense probably benign
IGL01420:Celsr3 APN 9 108,718,389 (GRCm39) critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108,708,907 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,711,756 (GRCm39) missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01631:Celsr3 APN 9 108,714,603 (GRCm39) missense probably benign 0.00
IGL01777:Celsr3 APN 9 108,713,141 (GRCm39) missense probably benign 0.08
IGL01938:Celsr3 APN 9 108,705,614 (GRCm39) missense probably benign 0.34
IGL02135:Celsr3 APN 9 108,704,755 (GRCm39) missense probably benign 0.11
IGL02231:Celsr3 APN 9 108,719,709 (GRCm39) missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108,707,159 (GRCm39) missense probably benign
IGL02392:Celsr3 APN 9 108,711,920 (GRCm39) splice site probably benign
IGL02416:Celsr3 APN 9 108,709,318 (GRCm39) missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108,717,662 (GRCm39) missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108,720,092 (GRCm39) missense probably benign 0.15
IGL02798:Celsr3 APN 9 108,720,774 (GRCm39) missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108,726,652 (GRCm39) missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108,723,134 (GRCm39) missense probably benign 0.12
IGL02986:Celsr3 APN 9 108,718,454 (GRCm39) splice site probably null
IGL03089:Celsr3 APN 9 108,703,806 (GRCm39) missense probably benign 0.04
IGL03162:Celsr3 APN 9 108,719,757 (GRCm39) missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108,713,724 (GRCm39) splice site probably benign
Diminishment UTSW 9 108,719,907 (GRCm39) intron probably benign
little_d UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
nogal UTSW 9 108,713,037 (GRCm39) missense probably benign
F6893:Celsr3 UTSW 9 108,712,266 (GRCm39) missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108,709,507 (GRCm39) missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108,722,932 (GRCm39) missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108,720,923 (GRCm39) splice site probably benign
R0382:Celsr3 UTSW 9 108,706,417 (GRCm39) missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108,706,272 (GRCm39) nonsense probably null
R0510:Celsr3 UTSW 9 108,704,204 (GRCm39) missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108,704,891 (GRCm39) missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108,711,854 (GRCm39) missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108,705,017 (GRCm39) missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108,719,832 (GRCm39) missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108,723,224 (GRCm39) missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108,710,375 (GRCm39) missense probably benign 0.17
R1321:Celsr3 UTSW 9 108,713,069 (GRCm39) missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108,704,104 (GRCm39) missense probably benign 0.00
R1497:Celsr3 UTSW 9 108,726,064 (GRCm39) missense probably benign 0.14
R1520:Celsr3 UTSW 9 108,725,857 (GRCm39) missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108,726,083 (GRCm39) missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108,706,267 (GRCm39) missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108,720,151 (GRCm39) nonsense probably null
R1753:Celsr3 UTSW 9 108,709,056 (GRCm39) missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108,706,157 (GRCm39) missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108,711,825 (GRCm39) missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1839:Celsr3 UTSW 9 108,707,105 (GRCm39) missense probably benign
R1874:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1875:Celsr3 UTSW 9 108,713,037 (GRCm39) missense probably benign
R1953:Celsr3 UTSW 9 108,720,381 (GRCm39) missense probably benign 0.19
R1960:Celsr3 UTSW 9 108,723,016 (GRCm39) missense probably benign
R2113:Celsr3 UTSW 9 108,715,669 (GRCm39) missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108,720,423 (GRCm39) missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2373:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2374:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2375:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R2844:Celsr3 UTSW 9 108,706,507 (GRCm39) missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108,709,390 (GRCm39) missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108,714,338 (GRCm39) missense probably benign 0.31
R3159:Celsr3 UTSW 9 108,704,909 (GRCm39) missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108,719,751 (GRCm39) missense probably benign
R4194:Celsr3 UTSW 9 108,720,501 (GRCm39) critical splice donor site probably null
R4329:Celsr3 UTSW 9 108,723,248 (GRCm39) missense probably benign 0.00
R4365:Celsr3 UTSW 9 108,707,046 (GRCm39) missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108,720,443 (GRCm39) missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108,723,262 (GRCm39) critical splice donor site probably null
R4582:Celsr3 UTSW 9 108,722,922 (GRCm39) missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108,704,953 (GRCm39) missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108,724,851 (GRCm39) missense probably benign 0.05
R4881:Celsr3 UTSW 9 108,721,140 (GRCm39) missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108,726,620 (GRCm39) missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108,714,759 (GRCm39) missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108,709,958 (GRCm39) missense probably benign 0.01
R5290:Celsr3 UTSW 9 108,720,357 (GRCm39) missense probably benign 0.01
R5327:Celsr3 UTSW 9 108,719,907 (GRCm39) intron probably benign
R5345:Celsr3 UTSW 9 108,709,323 (GRCm39) missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108,709,224 (GRCm39) missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108,705,781 (GRCm39) missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108,717,241 (GRCm39) missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108,721,233 (GRCm39) missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108,705,836 (GRCm39) missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108,721,743 (GRCm39) critical splice donor site probably null
R5629:Celsr3 UTSW 9 108,726,266 (GRCm39) missense probably benign 0.41
R5637:Celsr3 UTSW 9 108,714,332 (GRCm39) missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108,715,671 (GRCm39) missense probably benign 0.03
R5739:Celsr3 UTSW 9 108,704,357 (GRCm39) missense probably benign
R5785:Celsr3 UTSW 9 108,704,996 (GRCm39) missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108,722,926 (GRCm39) missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108,708,993 (GRCm39) missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108,714,350 (GRCm39) missense probably benign 0.01
R6176:Celsr3 UTSW 9 108,705,554 (GRCm39) missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108,706,041 (GRCm39) missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108,712,989 (GRCm39) missense probably benign 0.08
R6481:Celsr3 UTSW 9 108,714,283 (GRCm39) missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108,706,327 (GRCm39) missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108,704,549 (GRCm39) missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108,706,390 (GRCm39) missense probably benign 0.02
R6977:Celsr3 UTSW 9 108,704,914 (GRCm39) missense probably benign
R7061:Celsr3 UTSW 9 108,724,793 (GRCm39) nonsense probably null
R7122:Celsr3 UTSW 9 108,705,766 (GRCm39) missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108,715,203 (GRCm39) missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108,720,150 (GRCm39) missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108,722,961 (GRCm39) missense probably benign
R7213:Celsr3 UTSW 9 108,726,239 (GRCm39) missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108,706,343 (GRCm39) missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108,720,777 (GRCm39) missense probably benign 0.37
R7508:Celsr3 UTSW 9 108,713,821 (GRCm39) missense probably benign
R7554:Celsr3 UTSW 9 108,718,408 (GRCm39) missense probably benign
R7653:Celsr3 UTSW 9 108,712,269 (GRCm39) nonsense probably null
R7747:Celsr3 UTSW 9 108,707,177 (GRCm39) missense possibly damaging 0.61
R7881:Celsr3 UTSW 9 108,705,271 (GRCm39) missense probably benign 0.28
R7935:Celsr3 UTSW 9 108,706,840 (GRCm39) missense probably benign 0.01
R7995:Celsr3 UTSW 9 108,722,282 (GRCm39) missense probably damaging 0.99
R8006:Celsr3 UTSW 9 108,706,306 (GRCm39) missense probably damaging 1.00
R8077:Celsr3 UTSW 9 108,705,530 (GRCm39) missense probably benign 0.15
R8284:Celsr3 UTSW 9 108,723,612 (GRCm39) missense probably damaging 0.99
R8291:Celsr3 UTSW 9 108,715,169 (GRCm39) missense probably damaging 1.00
R8322:Celsr3 UTSW 9 108,725,993 (GRCm39) missense probably damaging 1.00
R8334:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8337:Celsr3 UTSW 9 108,718,471 (GRCm39) frame shift probably null
R8338:Celsr3 UTSW 9 108,704,539 (GRCm39) nonsense probably null
R8353:Celsr3 UTSW 9 108,703,734 (GRCm39) missense probably benign 0.00
R8407:Celsr3 UTSW 9 108,706,256 (GRCm39) missense probably damaging 1.00
R8408:Celsr3 UTSW 9 108,708,988 (GRCm39) missense probably damaging 1.00
R8459:Celsr3 UTSW 9 108,706,829 (GRCm39) missense probably damaging 1.00
R8510:Celsr3 UTSW 9 108,715,319 (GRCm39) missense possibly damaging 0.93
R8713:Celsr3 UTSW 9 108,707,062 (GRCm39) missense probably benign
R8728:Celsr3 UTSW 9 108,723,940 (GRCm39) missense probably benign 0.24
R8829:Celsr3 UTSW 9 108,717,582 (GRCm39) missense probably benign
R8877:Celsr3 UTSW 9 108,706,877 (GRCm39) missense probably damaging 1.00
R8905:Celsr3 UTSW 9 108,718,501 (GRCm39) missense probably damaging 1.00
R9008:Celsr3 UTSW 9 108,706,151 (GRCm39) missense possibly damaging 0.94
R9072:Celsr3 UTSW 9 108,704,293 (GRCm39) missense probably benign
R9157:Celsr3 UTSW 9 108,707,185 (GRCm39) missense probably damaging 1.00
R9183:Celsr3 UTSW 9 108,706,595 (GRCm39) missense probably damaging 1.00
R9275:Celsr3 UTSW 9 108,715,689 (GRCm39) missense probably benign 0.27
R9361:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9382:Celsr3 UTSW 9 108,706,961 (GRCm39) missense possibly damaging 0.60
R9407:Celsr3 UTSW 9 108,723,596 (GRCm39) missense probably damaging 1.00
R9432:Celsr3 UTSW 9 108,726,032 (GRCm39) missense probably benign 0.00
R9607:Celsr3 UTSW 9 108,717,701 (GRCm39) critical splice donor site probably null
R9626:Celsr3 UTSW 9 108,726,521 (GRCm39) missense probably damaging 1.00
R9628:Celsr3 UTSW 9 108,703,559 (GRCm39) nonsense probably null
R9630:Celsr3 UTSW 9 108,704,296 (GRCm39) missense probably benign
R9645:Celsr3 UTSW 9 108,704,691 (GRCm39) nonsense probably null
R9683:Celsr3 UTSW 9 108,704,522 (GRCm39) missense probably damaging 1.00
R9794:Celsr3 UTSW 9 108,728,502 (GRCm39) missense probably benign 0.00
R9798:Celsr3 UTSW 9 108,705,794 (GRCm39) missense probably damaging 1.00
RF020:Celsr3 UTSW 9 108,726,256 (GRCm39) missense probably benign
X0018:Celsr3 UTSW 9 108,717,611 (GRCm39) missense probably benign 0.01
X0018:Celsr3 UTSW 9 108,704,977 (GRCm39) missense possibly damaging 0.65
X0026:Celsr3 UTSW 9 108,706,129 (GRCm39) missense probably damaging 0.99
Z1177:Celsr3 UTSW 9 108,703,676 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGTGGCTATTTTGGTCAGCAC -3'
(R):5'- AGACTTGCCTCAGATGGGTTTAG -3'

Sequencing Primer
(F):5'- TTGGTCAGCACTGTGAGCAC -3'
(R):5'- CCTCAGATGGGTTTAGAGGTGAAG -3'
Posted On 2019-10-24