Incidental Mutation 'R7615:Auh'
ID 588873
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene Name AU RNA binding protein/enoyl-coenzyme A hydratase
Synonyms W91705
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7615 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 52835119-52929681 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52919013 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 111 (I111V)
Ref Sequence ENSEMBL: ENSMUSP00000021913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913] [ENSMUST00000110031] [ENSMUST00000119311] [ENSMUST00000120535] [ENSMUST00000123599]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021913
AA Change: I111V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460
AA Change: I111V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110031
AA Change: I111V

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105658
Gene: ENSMUSG00000021460
AA Change: I111V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH 57 120 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119311
AA Change: I111V

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113659
Gene: ENSMUSG00000021460
AA Change: I111V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 115 2.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120535
AA Change: I111V

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112427
Gene: ENSMUSG00000021460
AA Change: I111V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 142 1.3e-15 PFAM
Pfam:ECH_2 64 139 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123599
AA Change: I72V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116179
Gene: ENSMUSG00000021460
AA Change: I72V

DomainStartEndE-ValueType
Pfam:ECH_1 21 217 1.7e-48 PFAM
Pfam:ECH_2 25 211 9.8e-30 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121852
Gene: ENSMUSG00000021460
AA Change: I37V

DomainStartEndE-ValueType
Pfam:ECH_2 1 179 1.9e-28 PFAM
Pfam:ECH_1 1 236 1.1e-51 PFAM
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik T C 7: 43,497,849 I320V possibly damaging Het
Adat2 A G 10: 13,553,276 K4R probably benign Het
Adgb G A 10: 10,436,010 L226F probably damaging Het
Adgrb3 C T 1: 25,098,897 V1192I probably damaging Het
Ahsa2 T A 11: 23,496,750 N71I possibly damaging Het
Amigo2 T G 15: 97,245,342 T400P probably damaging Het
Ankhd1 A T 18: 36,656,773 Q466L Het
Brwd1 A G 16: 96,033,839 F942L probably damaging Het
C1qtnf7 A G 5: 43,616,144 N262D probably damaging Het
Cdh9 T A 15: 16,856,230 S785R probably damaging Het
Celsr3 A G 9: 108,837,652 T2046A possibly damaging Het
Cep170b T C 12: 112,744,665 V1493A probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Chd2 T A 7: 73,441,642 H1617L probably damaging Het
Clnk T C 5: 38,706,698 D404G probably damaging Het
Col18a1 C T 10: 77,067,005 G795D probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Ddx58 T A 4: 40,229,653 I89F possibly damaging Het
Dnah17 T A 11: 118,110,547 K857* probably null Het
Dnah2 T G 11: 69,435,304 I3674L probably damaging Het
Dnah6 A C 6: 73,095,206 I2431S possibly damaging Het
Eml6 T A 11: 29,802,501 I971F possibly damaging Het
Fam135b A T 15: 71,463,323 I674N probably damaging Het
Fancc T A 13: 63,317,558 probably null Het
Gabrb2 A C 11: 42,626,742 K464Q probably benign Het
Gbp4 T A 5: 105,122,982 D261V possibly damaging Het
Gdf3 A G 6: 122,606,916 V164A probably benign Het
Gm19410 A G 8: 35,796,359 D978G probably damaging Het
Gm20730 C T 6: 43,081,774 G35R probably null Het
Gm9733 A G 3: 15,320,485 V119A probably damaging Het
Grin2b G A 6: 135,923,364 T173I probably damaging Het
Gtf3c3 A T 1: 54,423,572 V344E possibly damaging Het
Hsd3b5 A G 3: 98,630,104 I32T probably damaging Het
Ido1 G C 8: 24,593,188 L74V probably damaging Het
Igkv1-88 T A 6: 68,862,373 D85V probably damaging Het
Il22ra1 A G 4: 135,737,459 I159V probably benign Het
Iqgap1 A T 7: 80,730,100 F1175Y probably damaging Het
Iqgap1 A G 7: 80,751,346 V531A probably benign Het
Itga1 T A 13: 114,996,922 Q484L probably null Het
Itga11 A T 9: 62,744,018 E281V probably benign Het
Kpna3 T C 14: 61,372,962 N343S possibly damaging Het
Larp1b A G 3: 41,033,534 K64E possibly damaging Het
Larp1b A G 3: 41,035,816 N133S probably benign Het
Lctl T A 9: 64,122,110 L161H probably damaging Het
Mlip A G 9: 77,230,483 S381P probably damaging Het
Mroh9 A G 1: 163,046,032 I518T probably benign Het
Mst1r A G 9: 107,920,012 Q1360R probably benign Het
Muc5b T A 7: 141,864,892 C3858* probably null Het
Naip1 A T 13: 100,425,776 H960Q probably benign Het
Narfl C T 17: 25,782,129 P452S probably benign Het
Neo1 A T 9: 58,884,503 S1321T probably benign Het
Nid2 C A 14: 19,802,530 T1102K probably damaging Het
Nsmaf C T 4: 6,408,563 V739M probably damaging Het
Olfr1019 T A 2: 85,841,657 M45L probably benign Het
Olfr1167 T C 2: 88,149,518 Q167R probably benign Het
Olfr1464-ps1 A G 19: 13,282,590 I156T probably damaging Het
Olfr727 T G 14: 50,126,989 S137R probably benign Het
Olfr97 T G 17: 37,231,450 K307Q probably benign Het
Osbpl9 G A 4: 109,086,339 P159S probably damaging Het
Parpbp A G 10: 88,093,637 S450P probably damaging Het
Pdgfrb A G 18: 61,064,046 T185A probably benign Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plau A T 14: 20,839,466 K200* probably null Het
Plce1 A T 19: 38,524,665 Q136L probably benign Het
Plekhd1 C T 12: 80,722,445 T493I probably benign Het
Pofut1 T C 2: 153,259,418 S31P unknown Het
Prlr T A 15: 10,325,924 I243N probably damaging Het
Ptgis A G 2: 167,223,988 L174P probably damaging Het
Ralgapb T A 2: 158,450,270 I792K probably damaging Het
Retreg3 C T 11: 101,102,980 S136N probably damaging Het
Rnf213 C T 11: 119,467,297 T4291M Het
Rtn1 A G 12: 72,304,143 Y431H probably damaging Het
Rwdd3 A G 3: 121,171,604 probably benign Het
Scyl3 A T 1: 163,950,338 probably null Het
Sh2b2 G T 5: 136,219,657 Q510K probably damaging Het
Sh2b3 G A 5: 121,818,700 P333S probably benign Het
Slc27a6 A T 18: 58,609,183 N490Y probably damaging Het
Slc45a1 C T 4: 150,638,545 R294Q probably benign Het
Sorl1 A C 9: 41,977,582 I1974S possibly damaging Het
Specc1l C A 10: 75,263,286 N857K probably benign Het
Speg T C 1: 75,429,242 L3030P probably damaging Het
Spsb1 A C 4: 149,906,900 D70E probably benign Het
Srsf11 A G 3: 158,016,425 S270P unknown Het
Ssr3 A C 3: 65,387,792 V100G probably damaging Het
Synpo G A 18: 60,604,475 T133I probably damaging Het
Tas2r120 T G 6: 132,657,810 V285G probably benign Het
Tenm4 T A 7: 96,845,926 V1187D probably damaging Het
Tmed8 C A 12: 87,181,388 probably null Het
Tmem51 G A 4: 142,037,564 T61M probably damaging Het
Tonsl A T 15: 76,630,607 D1132E probably benign Het
Tor1aip1 C T 1: 156,007,584 V358I possibly damaging Het
Txlna A T 4: 129,630,319 M415K probably damaging Het
Tyms T A 5: 30,073,560 probably benign Het
Uggt2 G T 14: 119,089,269 L177I probably benign Het
Uqcrh T C 4: 116,069,879 H74R probably benign Het
Wnk1 A T 6: 119,932,738 S33T probably benign Het
Zfp553 T A 7: 127,236,016 C248S probably damaging Het
Zfp574 G A 7: 25,080,576 C341Y possibly damaging Het
Zfp729b T C 13: 67,591,498 T883A possibly damaging Het
Zfp738 T A 13: 67,670,203 K556N probably damaging Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1480:Auh UTSW 13 52835496 missense probably benign 0.00
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1581:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2429:Auh UTSW 13 52919016 missense probably damaging 1.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R2960:Auh UTSW 13 52839574 missense probably damaging 1.00
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6434:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R8379:Auh UTSW 13 52909313 makesense probably null
R8774:Auh UTSW 13 52839595 missense probably benign 0.21
R8774-TAIL:Auh UTSW 13 52839595 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCAGCTTCCATCAAATGCCTG -3'
(R):5'- TGGTGAGTGGAAGACTACGC -3'

Sequencing Primer
(F):5'- TGTGGCTCCATCCCCAAG -3'
(R):5'- GAAGACTACGCTGTTTGCTTC -3'
Posted On 2019-10-24