Mutagenetix > Incidental Mutation

Incidental Mutation 'R7615:Itga1'

588878

Institutional Source

Beutler Lab

Gene Symbol

Itga1

Ensembl Gene

ENSMUSG00000042284

Gene Name

integrin alpha 1

Synonyms

CD49A, Vla1, E130012M19Rik

MMRRC Submission

045683-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R7615 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114953096-115101964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114996922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 484 (Q484L)

Ref Sequence

ENSEMBL: ENSMUSP00000077132 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061673] [ENSMUST00000061673]

AlphaFold

Q3V3R4

Predicted Effect

probably null
Transcript: ENSMUST00000061673
AA Change: Q484L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: Q484L

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000061673
AA Change: Q484L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: Q484L

Domain	Start	End	E-Value	Type
Int_alpha	43	96	1.63e0	SMART
VWA	170	360	4.24e-44	SMART
Int_alpha	432	481	4.21e-3	SMART
Int_alpha	485	542	3.19e-12	SMART
Int_alpha	566	621	1.79e-15	SMART
Int_alpha	628	682	3.04e1	SMART
low complexity region	1108	1122	N/A	INTRINSIC
PDB:2L8S\|A	1135	1179	5e-10	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (101/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	T	C	7: 43,497,849	I320V	possibly damaging	Het
Adat2	A	G	10: 13,553,276	K4R	probably benign	Het
Adgb	G	A	10: 10,436,010	L226F	probably damaging	Het
Adgrb3	C	T	1: 25,098,897	V1192I	probably damaging	Het
Ahsa2	T	A	11: 23,496,750	N71I	possibly damaging	Het
Amigo2	T	G	15: 97,245,342	T400P	probably damaging	Het
Ankhd1	A	T	18: 36,656,773	Q466L		Het
Auh	T	C	13: 52,919,013	I111V	probably benign	Het
Brwd1	A	G	16: 96,033,839	F942L	probably damaging	Het
C1qtnf7	A	G	5: 43,616,144	N262D	probably damaging	Het
Cdh9	T	A	15: 16,856,230	S785R	probably damaging	Het
Celsr3	A	G	9: 108,837,652	T2046A	possibly damaging	Het
Cep170b	T	C	12: 112,744,665	V1493A	probably damaging	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Chd2	T	A	7: 73,441,642	H1617L	probably damaging	Het
Clnk	T	C	5: 38,706,698	D404G	probably damaging	Het
Col18a1	C	T	10: 77,067,005	G795D	probably damaging	Het
Csf3r	T	A	4: 126,037,656	Y477*	probably null	Het
Ddx58	T	A	4: 40,229,653	I89F	possibly damaging	Het
Dnah17	T	A	11: 118,110,547	K857*	probably null	Het
Dnah2	T	G	11: 69,435,304	I3674L	probably damaging	Het
Dnah6	A	C	6: 73,095,206	I2431S	possibly damaging	Het
Eml6	T	A	11: 29,802,501	I971F	possibly damaging	Het
Fam135b	A	T	15: 71,463,323	I674N	probably damaging	Het
Fancc	T	A	13: 63,317,558		probably null	Het
Gabrb2	A	C	11: 42,626,742	K464Q	probably benign	Het
Gbp4	T	A	5: 105,122,982	D261V	possibly damaging	Het
Gdf3	A	G	6: 122,606,916	V164A	probably benign	Het
Gm19410	A	G	8: 35,796,359	D978G	probably damaging	Het
Gm20730	C	T	6: 43,081,774	G35R	probably null	Het
Gm9733	A	G	3: 15,320,485	V119A	probably damaging	Het
Grin2b	G	A	6: 135,923,364	T173I	probably damaging	Het
Gtf3c3	A	T	1: 54,423,572	V344E	possibly damaging	Het
Hsd3b5	A	G	3: 98,630,104	I32T	probably damaging	Het
Ido1	G	C	8: 24,593,188	L74V	probably damaging	Het
Igkv1-88	T	A	6: 68,862,373	D85V	probably damaging	Het
Il22ra1	A	G	4: 135,737,459	I159V	probably benign	Het
Iqgap1	A	T	7: 80,730,100	F1175Y	probably damaging	Het
Iqgap1	A	G	7: 80,751,346	V531A	probably benign	Het
Itga11	A	T	9: 62,744,018	E281V	probably benign	Het
Kpna3	T	C	14: 61,372,962	N343S	possibly damaging	Het
Larp1b	A	G	3: 41,033,534	K64E	possibly damaging	Het
Larp1b	A	G	3: 41,035,816	N133S	probably benign	Het
Lctl	T	A	9: 64,122,110	L161H	probably damaging	Het
Mlip	A	G	9: 77,230,483	S381P	probably damaging	Het
Mroh9	A	G	1: 163,046,032	I518T	probably benign	Het
Mst1r	A	G	9: 107,920,012	Q1360R	probably benign	Het
Muc5b	T	A	7: 141,864,892	C3858*	probably null	Het
Naip1	A	T	13: 100,425,776	H960Q	probably benign	Het
Narfl	C	T	17: 25,782,129	P452S	probably benign	Het
Neo1	A	T	9: 58,884,503	S1321T	probably benign	Het
Nid2	C	A	14: 19,802,530	T1102K	probably damaging	Het
Nsmaf	C	T	4: 6,408,563	V739M	probably damaging	Het
Olfr1019	T	A	2: 85,841,657	M45L	probably benign	Het
Olfr1167	T	C	2: 88,149,518	Q167R	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,590	I156T	probably damaging	Het
Olfr727	T	G	14: 50,126,989	S137R	probably benign	Het
Olfr97	T	G	17: 37,231,450	K307Q	probably benign	Het
Osbpl9	G	A	4: 109,086,339	P159S	probably damaging	Het
Parpbp	A	G	10: 88,093,637	S450P	probably damaging	Het
Pdgfrb	A	G	18: 61,064,046	T185A	probably benign	Het
Pkd1	T	C	17: 24,593,502	V3803A	probably damaging	Het
Plau	A	T	14: 20,839,466	K200*	probably null	Het
Plce1	A	T	19: 38,524,665	Q136L	probably benign	Het
Plekhd1	C	T	12: 80,722,445	T493I	probably benign	Het
Pofut1	T	C	2: 153,259,418	S31P	unknown	Het
Prlr	T	A	15: 10,325,924	I243N	probably damaging	Het
Ptgis	A	G	2: 167,223,988	L174P	probably damaging	Het
Ralgapb	T	A	2: 158,450,270	I792K	probably damaging	Het
Retreg3	C	T	11: 101,102,980	S136N	probably damaging	Het
Rnf213	C	T	11: 119,467,297	T4291M		Het
Rtn1	A	G	12: 72,304,143	Y431H	probably damaging	Het
Rwdd3	A	G	3: 121,171,604		probably benign	Het
Scyl3	A	T	1: 163,950,338		probably null	Het
Sh2b2	G	T	5: 136,219,657	Q510K	probably damaging	Het
Sh2b3	G	A	5: 121,818,700	P333S	probably benign	Het
Slc27a6	A	T	18: 58,609,183	N490Y	probably damaging	Het
Slc45a1	C	T	4: 150,638,545	R294Q	probably benign	Het
Sorl1	A	C	9: 41,977,582	I1974S	possibly damaging	Het
Specc1l	C	A	10: 75,263,286	N857K	probably benign	Het
Speg	T	C	1: 75,429,242	L3030P	probably damaging	Het
Spsb1	A	C	4: 149,906,900	D70E	probably benign	Het
Srsf11	A	G	3: 158,016,425	S270P	unknown	Het
Ssr3	A	C	3: 65,387,792	V100G	probably damaging	Het
Synpo	G	A	18: 60,604,475	T133I	probably damaging	Het
Tas2r120	T	G	6: 132,657,810	V285G	probably benign	Het
Tenm4	T	A	7: 96,845,926	V1187D	probably damaging	Het
Tmed8	C	A	12: 87,181,388		probably null	Het
Tmem51	G	A	4: 142,037,564	T61M	probably damaging	Het
Tonsl	A	T	15: 76,630,607	D1132E	probably benign	Het
Tor1aip1	C	T	1: 156,007,584	V358I	possibly damaging	Het
Txlna	A	T	4: 129,630,319	M415K	probably damaging	Het
Tyms	T	A	5: 30,073,560		probably benign	Het
Uggt2	G	T	14: 119,089,269	L177I	probably benign	Het
Uqcrh	T	C	4: 116,069,879	H74R	probably benign	Het
Wnk1	A	T	6: 119,932,738	S33T	probably benign	Het
Zfp553	T	A	7: 127,236,016	C248S	probably damaging	Het
Zfp574	G	A	7: 25,080,576	C341Y	possibly damaging	Het
Zfp729b	T	C	13: 67,591,498	T883A	possibly damaging	Het
Zfp738	T	A	13: 67,670,203	K556N	probably damaging	Het

Other mutations in Itga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Itga1	APN	13	114992363	missense	possibly damaging	0.80
IGL00498:Itga1	APN	13	115031193	missense	probably benign	0.00
IGL00549:Itga1	APN	13	115049296	missense	possibly damaging	0.92
IGL00587:Itga1	APN	13	115012249	missense	probably damaging	1.00
IGL01021:Itga1	APN	13	114997000	missense	probably benign	0.29
IGL01289:Itga1	APN	13	114986226	missense	possibly damaging	0.79
IGL01636:Itga1	APN	13	115006948	missense	possibly damaging	0.73
IGL01791:Itga1	APN	13	114987661	missense	probably benign	0.00
IGL01796:Itga1	APN	13	114985121	missense	probably damaging	1.00
IGL02027:Itga1	APN	13	114990055	splice site	probably null
IGL02330:Itga1	APN	13	115012204	missense	probably damaging	1.00
IGL02480:Itga1	APN	13	114987648	missense	probably damaging	1.00
IGL02943:Itga1	APN	13	115049296	missense	possibly damaging	0.92
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0103:Itga1	UTSW	13	115016254	missense	probably benign	0.40
R0244:Itga1	UTSW	13	115006897	splice site	probably benign
R0265:Itga1	UTSW	13	114992459	missense	probably benign
R0302:Itga1	UTSW	13	115012318	splice site	probably benign
R0320:Itga1	UTSW	13	114977594	splice site	probably benign
R0389:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0443:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R0574:Itga1	UTSW	13	114966561	missense	probably damaging	1.00
R0646:Itga1	UTSW	13	114968299	missense	probably benign
R0830:Itga1	UTSW	13	115007032	missense	probably benign	0.08
R2162:Itga1	UTSW	13	115030910	missense	probably benign	0.23
R2216:Itga1	UTSW	13	114997029	missense	probably benign	0.00
R2403:Itga1	UTSW	13	114977614	missense	probably benign	0.00
R3734:Itga1	UTSW	13	114977639	missense	probably benign
R4171:Itga1	UTSW	13	115030886	nonsense	probably null
R4402:Itga1	UTSW	13	115001566	missense	probably benign	0.00
R4675:Itga1	UTSW	13	115001691	splice site	probably null
R4684:Itga1	UTSW	13	115049370	missense	probably damaging	1.00
R4795:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4796:Itga1	UTSW	13	115035385	missense	probably damaging	1.00
R4845:Itga1	UTSW	13	114974172	nonsense	probably null
R5147:Itga1	UTSW	13	114985142	missense	possibly damaging	0.91
R5155:Itga1	UTSW	13	115035303	missense	probably benign
R5234:Itga1	UTSW	13	115049303	nonsense	probably null
R5344:Itga1	UTSW	13	115002309	missense	possibly damaging	0.78
R5554:Itga1	UTSW	13	114992474	nonsense	probably null
R5662:Itga1	UTSW	13	114986171	missense	probably benign	0.03
R5945:Itga1	UTSW	13	114966590	missense	probably benign	0.02
R6150:Itga1	UTSW	13	114968233	missense	probably benign	0.01
R6241:Itga1	UTSW	13	114960137	splice site	probably null
R6276:Itga1	UTSW	13	114980852	missense	probably benign
R6369:Itga1	UTSW	13	114965660	missense	probably damaging	1.00
R6511:Itga1	UTSW	13	114992501	missense	probably damaging	0.98
R6663:Itga1	UTSW	13	114974105	missense	probably benign	0.02
R6783:Itga1	UTSW	13	114996977	missense	probably benign	0.22
R6931:Itga1	UTSW	13	115001563	missense	probably benign	0.39
R7069:Itga1	UTSW	13	114968240	missense	probably damaging	1.00
R7458:Itga1	UTSW	13	114986266	missense	probably benign	0.00
R7588:Itga1	UTSW	13	114968249	missense	possibly damaging	0.88
R7591:Itga1	UTSW	13	114982779	missense	probably damaging	1.00
R7597:Itga1	UTSW	13	114974140	missense	probably benign	0.28
R7756:Itga1	UTSW	13	114992460	missense	probably benign	0.04
R7795:Itga1	UTSW	13	115012236	missense	probably damaging	1.00
R7819:Itga1	UTSW	13	115049301	missense	probably damaging	0.99
R8193:Itga1	UTSW	13	114968455	critical splice donor site	probably null
R8313:Itga1	UTSW	13	114966584	missense	probably benign	0.06
R8419:Itga1	UTSW	13	115007068	missense	probably damaging	1.00
R8925:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8927:Itga1	UTSW	13	114968519	missense	probably benign	0.01
R8951:Itga1	UTSW	13	114970491	nonsense	probably null
R9099:Itga1	UTSW	13	115049320	missense	probably damaging	1.00
R9200:Itga1	UTSW	13	114968461	missense	possibly damaging	0.80
R9221:Itga1	UTSW	13	115030159	nonsense	probably null
R9249:Itga1	UTSW	13	115049298	missense	probably damaging	1.00
R9267:Itga1	UTSW	13	115049388	missense	possibly damaging	0.50
R9376:Itga1	UTSW	13	114970576	missense	probably benign	0.07
R9481:Itga1	UTSW	13	115016217	missense	probably benign	0.34
R9789:Itga1	UTSW	13	115035284	nonsense	probably null
Z1177:Itga1	UTSW	13	114985071	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTCCTGCCAGAAGAAATG -3'
(R):5'- GCCATTATGAGTCCAGGTCC -3'

Sequencing Primer
(F):5'- CTCCTGCCAGAAGAAATGCTTATG -3'
(R):5'- ATGAGTCCAGGTCCACATCTG -3'

Posted On

2019-10-24